Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34610
Trapped Gene
Ptprg (ENSMUSG00000021745)
Vector Insertion
Chr 14: 13058969 - 13069542
Public Clones IST13434A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000460554 (Chr14:13058826..13058968 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGGTTCGGCACTTTCAGT Chr14:13058840..13058859 58.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000460554 (Chr14:13058826..13058968 +)
Downstram Exon
ENSMUSE00000515706 (Chr14:13069543..13069678 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGGTTCGGCACTTTCAGT Chr14:13058840..13058859 58.94 50 ACAAGGTGGTAAGGGCACAC Chr14:13069592..13069611 59.89 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000490031 Chr14:12386046..12386846 ATCGTCCCTAGCTTGGCTTT Chr14:12386536..12386555 60.23 50
upstream ENSMUSE00000487137 Chr14:12553629..12553733 GACAGGACAGCTCAGTGCAG Chr14:12553668..12553687 59.76 60
upstream ENSMUSE00000488184 Chr14:12785230..12785409 ATGGGTTTGACAACGAGTCC Chr14:12785353..12785372 59.83 50
upstream ENSMUSE00000493040 Chr14:12795088..12795236 CCATCCTGCTGAAAGACGAT Chr14:12795091..12795110 60.22 50
upstream ENSMUSE00000486138 Chr14:12869855..12869950 GACAGCTTTCAAACGGCAAT Chr14:12869888..12869907 60.26 45
upstream ENSMUSE00000483484 Chr14:12923929..12923995 TATTATCCACGGGCTGAAGG Chr14:12923961..12923980 59.92 50
upstream ENSMUSE00000484478 Chr14:12942490..12942647 TCATTCTCCGAGACCTCCTG Chr14:12942514..12942533 60.34 55
upstream ENSMUSE00000489229 Chr14:12954492..12954684 TCTTGGACAACCCACTAGGC Chr14:12954649..12954668 60.11 55
upstream ENSMUSE00000482667 Chr14:12974898..12975082 GGACCAAGAATGAGGACGAG Chr14:12975024..12975043 59.65 55
upstream ENSMUSE00000479925 Chr14:12977890..12977998 TGTCTCACCCGATAGCCTTT Chr14:12977907..12977926 59.69 50
upstream ENSMUSE00000480906 Chr14:12984530..12984579 ACTACCCGGATCTTCCAAGG Chr14:12984535..12984554 60.32 55
upstream ENSMUSE00000485611 Chr14:12986172..12986940 AGTGGCAGCCAAGCTACAGT Chr14:12986295..12986314 60.08 55
upstream ENSMUSE00000479156 Chr14:12999259..12999391 CTCAGCCTTGACCTTCGTGT Chr14:12999335..12999354 60.44 55
upstream ENSMUSE00000476346 Chr14:13011778..13011864 GCCTTCTTCTGGGGAGAGAG Chr14:13011829..13011848 60.47 60
upstream ENSMUSE00000710844 Chr14:13022457..13022590 GCTGCGTGAACTGCTCATAG Chr14:13022507..13022526 59.77 55
upstream ENSMUSE00000477359 Chr14:13023196..13023287 CCCCAACGAAAGTGTTCCTAT Chr14:13023253..13023273 60.23 47.62
upstream ENSMUSE00000482159 Chr14:13032236..13032327 TGGTAAACACATCGGTGAGC Chr14:13032267..13032286 59.57 50
upstream ENSMUSE00000474718 Chr14:13039798..13039894 TCATCCGGATAACAAGCACA Chr14:13039848..13039867 60.07 45
upstream ENSMUSE00000472857 Chr14:13042782..13042864 No primer for this exon
upstream ENSMUSE00000294885 Chr14:13043054..13043188 GGAGGATGATCTGGGAACAA Chr14:13043121..13043140 59.86 50
upstream ENSMUSE00000120438 Chr14:13044099..13044233 CTACACCGTCCGTCGTCTTT Chr14:13044188..13044207 60.17 55
upstream ENSMUSE00000294867 Chr14:13046148..13046320 CCTTCGTGAGGAGGTCATCT Chr14:13046257..13046276 59.25 55
upstream ENSMUSE00000471722 Chr14:13047702..13047837 GCAGGACAGGCACCTACATT Chr14:13047713..13047732 60.14 55
upstream ENSMUSE00000469697 Chr14:13048376..13048522 GAAAGACACGGCTGGAAAAG Chr14:13048494..13048513 59.85 50
upstream ENSMUSE00000467625 Chr14:13051453..13051546 CAGGAACTCGTCTGTTGTGC Chr14:13051524..13051543 59.47 55
upstream ENSMUSE00000464689 Chr14:13052523..13052599 CCGGGATGAAAGGAACAGAT Chr14:13052556..13052575 61.21 50
upstream ENSMUSE00000351959 Chr14:13053106..13053234 CCTCTGCCACACACTACGAA Chr14:13053145..13053164 59.9 55
upstream ENSMUSE00000462585 Chr14:13057984..13058130 AGGCTATGCCTCTCGAATGA Chr14:13058068..13058087 59.94 50
upstream ENSMUSE00000460554 Chr14:13058826..13058968 AGAGGTTCGGCACTTTCAGT Chr14:13058840..13058859 58.94 50

*** Putative Vector Insertion (Chr 14: 13058969 - 13069542) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000515706 Chr14:13069543..13069678 ACAAGGTGGTAAGGGCACAC Chr14:13069592..13069611 59.89 55
downstream ENSMUSE00000519838 Chr14:13070241..13071077 GCTGTCCTGCAAAAGGAGAC Chr14:13070897..13070916 60 55
downstream ENSMUSE00000714956 Chr14:13070241..13074555 GCTGTCCTGCAAAAGGAGAC Chr14:13070897..13070916 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGGGTGCTGTTCTTACGAG Chr14:13064994..13065015 59.92 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGGGTGCTGTTCTTACGAG Chr14:13064994..13065015 59.92 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021745