Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34617
Trapped Gene
Gpr98 (ENSMUSG00000069170)
Vector Insertion
Chr 13: 81734419 - 81772144
Public Clones (sanger) IST10078F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680803 (Chr13:81772006..81772143 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAAAGGATTAGCGTTGCAG Chr13:81772122..81772141 59.85 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680803 (Chr13:81772006..81772143 -)
Downstram Exon
ENSMUSE00000640938 (Chr13:81734420..81734435 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAAAGGATTAGCGTTGCAG Chr13:81772122..81772141 59.85 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680803 Chr13:81772006..81772143 GGAAAGGATTAGCGTTGCAG Chr13:81772122..81772141 59.85 50
upstream ENSMUSE00000640938 Chr13:81734420..81734435 No primer for this exon

*** Putative Vector Insertion (Chr 13: 81734419 - 81772144) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640937 Chr13:81734176..81734360 GGCTCGCCTATCCTCTCAAT Chr13:81734179..81734198 60.7 55
downstream ENSMUSE00000641019 Chr13:81734176..81734357 GGCTCGCCTATCCTCTCAAT Chr13:81734179..81734198 60.7 55
downstream ENSMUSE00000641018 Chr13:81731989..81732138 TGCGGCGTATGTATCAAAAA Chr13:81732072..81732091 60.1 40
downstream ENSMUSE00000641017 Chr13:81731557..81731652 CTTGGCCATCCAAGTTTCAC Chr13:81731596..81731615 60.49 50
downstream ENSMUSE00000641016 Chr13:81723040..81723144 TCACGGTGACCATTCCATAG Chr13:81723026..81723045 59.37 50
downstream ENSMUSE00000641015 Chr13:81720691..81720804 GTCTTCCTCAGGGGGATTTG Chr13:81720750..81720769 60.82 55
downstream ENSMUSE00000641014 Chr13:81718284..81718849 CACTATCCTTCCCACGAAGC Chr13:81718632..81718651 59.69 55
downstream ENSMUSE00000641013 Chr13:81717719..81717995 GGTGAGGGATCACTGCTGTT Chr13:81717875..81717894 60.12 55
downstream ENSMUSE00000641012 Chr13:81717062..81717391 TCGCCAAACTCAGGGATAAG Chr13:81717252..81717271 60.21 50
downstream ENSMUSE00000641011 Chr13:81713958..81714134 GGGACTTACTGGTGGAATCG Chr13:81714059..81714078 59.4 55
downstream ENSMUSE00000641010 Chr13:81712214..81712437 TAAAAGGACCTGCGTCATCC Chr13:81712301..81712320 60.07 50
downstream ENSMUSE00000680765 Chr13:81709482..81709564 TTCCACCCTGTCAACACAGA Chr13:81709486..81709505 60.13 50
downstream ENSMUSE00000641009 Chr13:81707607..81707733 CTCCAGGGTCATCATTTTCC Chr13:81707632..81707651 59.34 50
downstream ENSMUSE00000641008 Chr13:81707336..81707521 TGAAAGCGGAGGAACTGTTT Chr13:81707429..81707448 59.85 45
downstream ENSMUSE00000641007 Chr13:81706330..81706510 AGTGTAGCACAGCCCAGCTT Chr13:81706418..81706437 60.08 55
downstream ENSMUSE00000641006 Chr13:81705261..81705424 CACCAAAGTTGCCTCGAGTT Chr13:81705364..81705383 60.29 50
downstream ENSMUSE00000641005 Chr13:81703981..81704104 GCAGTTGTCCTGATCCCTGT Chr13:81704003..81704022 60.12 55
downstream ENSMUSE00000641004 Chr13:81702563..81702829 CTCCACAGGAGCGAAGTCTC Chr13:81702662..81702681 60.13 60
downstream ENSMUSE00000641003 Chr13:81700453..81700579 AACACCATTTGGGTCATCGT Chr13:81700487..81700506 60.1 45
downstream ENSMUSE00000641002 Chr13:81699649..81699863 AAAGCACGGAGAATGACTGG Chr13:81699686..81699705 60.26 50
downstream ENSMUSE00000640933 Chr13:81699573..81699863 AAAGCACGGAGAATGACTGG Chr13:81699686..81699705 60.26 50
downstream ENSMUSE00000641001 Chr13:81697919..81698650 GGGATCAACAGTCCCAAATG Chr13:81698249..81698268 60.17 50
downstream ENSMUSE00000641000 Chr13:81695949..81696322 GGCACAGCATGAAGTTCGTA Chr13:81696174..81696193 59.87 50
downstream ENSMUSE00000640999 Chr13:81683467..81683643 GGCAAAATCATCAACGAGGT Chr13:81683490..81683509 59.94 45
downstream ENSMUSE00000640998 Chr13:81682368..81682548 AGGATCTATGCTGGCACCAC Chr13:81682395..81682414 60.1 55
downstream ENSMUSE00000640997 Chr13:81678958..81679160 CTTGTGCACGAATGACCAGT Chr13:81679007..81679026 59.75 50
downstream ENSMUSE00000640996 Chr13:81675309..81675438 TTCCAGTTCAGGGATGGAAT Chr13:81675327..81675346 59.34 45
downstream ENSMUSE00000640995 Chr13:81672010..81672090 TGCCATCAACCCTAAAGAGG Chr13:81672042..81672061 60.07 50
downstream ENSMUSE00000640994 Chr13:81670566..81670705 AATTCAAACACCCCATGAGC Chr13:81670611..81670630 59.8 45
downstream ENSMUSE00000640993 Chr13:81667448..81668057 GCCAGATGTAATGGCGAGAT Chr13:81667946..81667965 60.07 50
downstream ENSMUSE00000640992 Chr13:81664313..81664528 AATAACGAGATGGGCCACAG Chr13:81664451..81664470 59.96 50
downstream ENSMUSE00000640991 Chr13:81663558..81663773 ACAGTCCGTAGGGGTCATCA Chr13:81663539..81663558 60.39 55
downstream ENSMUSE00000640990 Chr13:81662535..81662779 ATTGGCACGTTTACCCTCAC Chr13:81662691..81662710 59.86 50
downstream ENSMUSE00000640989 Chr13:81661104..81661285 AGAGGCTCTTGGACACGAAA Chr13:81661121..81661140 59.99 50
downstream ENSMUSE00000640988 Chr13:81659502..81660313 TCAACTGCACGAGCCACTAC Chr13:81660220..81660239 60.06 55
downstream ENSMUSE00000640987 Chr13:81656952..81657161 CATTGTCGTTTGCCAAGATG Chr13:81656984..81657003 60.11 45
downstream ENSMUSE00000640985 Chr13:81650494..81650624 GTTGGCCCGTAAAGTTAGCA Chr13:81650486..81650505 60.13 50
downstream ENSMUSE00000640984 Chr13:81649849..81649948 No primer for this exon
downstream ENSMUSE00000640983 Chr13:81648365..81648544 TTAAAACACCGTGTGGCTCA Chr13:81648430..81648449 60.15 45
downstream ENSMUSE00000640982 Chr13:81647655..81647818 CTCTGGCTCTGCTAGGTTGC Chr13:81647714..81647733 60.3 60
downstream ENSMUSE00000640981 Chr13:81645098..81645191 GGGAGGAGATGAAGTCAGAGG Chr13:81645083..81645103 60.2 57.14
downstream ENSMUSE00000680764 Chr13:81644732..81645191 GCGGTGTTACGTTCCCATAA Chr13:81644978..81644997 60.75 50
downstream ENSMUSE00000640979 Chr13:81643091..81643169 ATGACAATCTGTGCCGTCAG Chr13:81643117..81643136 59.71 50
downstream ENSMUSE00000640978 Chr13:81642853..81642991 CTCCTCTGCGCTACCAGTGT Chr13:81642919..81642938 60.61 60
downstream ENSMUSE00000640977 Chr13:81642002..81642143 TCCAGAATCATGACGTCCAC Chr13:81642066..81642085 59.48 50
downstream ENSMUSE00000640975 Chr13:81637984..81638246 CTGGTTCCCGAACAATGACT Chr13:81638087..81638106 59.97 50
downstream ENSMUSE00000640974 Chr13:81635191..81635366 CCATTTCTGGTTCCGTGTCT Chr13:81635302..81635321 59.97 50
downstream ENSMUSE00000640972 Chr13:81633573..81633697 CACTCGCAGTCAAGTCAAGG Chr13:81633590..81633609 59.62 55
downstream ENSMUSE00000640970 Chr13:81632114..81632271 AGTCCCTTGCCATCGATAAA Chr13:81632107..81632126 59.53 45
downstream ENSMUSE00000640969 Chr13:81631873..81632019 GATATGGGGAAACGCCAATA Chr13:81631937..81631956 59.62 45
downstream ENSMUSE00000640968 Chr13:81631456..81631563 GAGGTGAAATGCCGTACTTGA Chr13:81631492..81631512 60.12 47.62
downstream ENSMUSE00000640967 Chr13:81627906..81628170 AAACATCATCGCCTGAGGAC Chr13:81627914..81627933 60.08 50
downstream ENSMUSE00000640965 Chr13:81626851..81626973 CAAAGTCCAGGGATTGGAAA Chr13:81626874..81626893 59.9 45
downstream ENSMUSE00000640964 Chr13:81620848..81621070 GTGCTTCCAGGACGAAAGAG Chr13:81620962..81620981 59.99 55
downstream ENSMUSE00000640963 Chr13:81620312..81620516 CATCATTGGCGAGAACAGTG Chr13:81620319..81620338 60.26 50
downstream ENSMUSE00000640962 Chr13:81618628..81618774 ACCAGGCTATCTCGTTCCAA Chr13:81618706..81618725 59.69 50
downstream ENSMUSE00000640961 Chr13:81615480..81615735 CATCCGCAAGAACAGTCAGA Chr13:81615656..81615675 59.98 50
downstream ENSMUSE00000640960 Chr13:81613931..81614133 AATGGCGACTTCAGCATGAG Chr13:81613915..81613934 61.35 50
downstream ENSMUSE00000640959 Chr13:81611882..81612058 TATCTCCGCTGACTCCATCC Chr13:81611914..81611933 60.18 55
downstream ENSMUSE00000640958 Chr13:81611395..81611577 CATCCGGACAACAGGAACTT Chr13:81611481..81611500 59.97 50
downstream ENSMUSE00000640957 Chr13:81605161..81605340 TTCACCGAAACATCATCACC Chr13:81605197..81605216 59.35 45
downstream ENSMUSE00000640956 Chr13:81598675..81598839 TGAAGTCGGACAGCTCCTTT Chr13:81598720..81598739 59.99 50
downstream ENSMUSE00000640955 Chr13:81587834..81587951 ACCATGCCGTCCTTAAGTGT Chr13:81587880..81587899 59.48 50
downstream ENSMUSE00000640953 Chr13:81585378..81585498 TGAGGGTTCCCCAATAATGA Chr13:81585385..81585404 60.13 45
downstream ENSMUSE00000640950 Chr13:81584212..81584350 CATCCAGCATCGTCAGTTGT Chr13:81584219..81584238 59.71 50
downstream ENSMUSE00000640949 Chr13:81583849..81584034 GAAAATGAGAACCGGCCATA Chr13:81583864..81583883 59.9 45
downstream ENSMUSE00000640948 Chr13:81583345..81583577 GGCAAGAACGAATTCCTCAG Chr13:81583349..81583368 59.81 50
downstream ENSMUSE00000612498 Chr13:81581465..81581613 TCCCAATTTCAGGAGGTTGA Chr13:81581530..81581549 60.43 45
downstream ENSMUSE00000612497 Chr13:81579047..81579242 TGTCCATGCTGAAAGGTGAC Chr13:81579070..81579089 59.68 50
downstream ENSMUSE00000612496 Chr13:81578412..81578631 GATGCCAAAGGGAGAGTCAC Chr13:81578495..81578514 59.66 55
downstream ENSMUSE00000612495 Chr13:81576468..81576704 GGTAACGGTTCCTCAGCATC Chr13:81576639..81576658 59.56 55
downstream ENSMUSE00000612494 Chr13:81574559..81574708 GACCTTGTGACGAGGAAGGA Chr13:81574562..81574581 60.24 55
downstream ENSMUSE00000612493 Chr13:81572424..81572897 AGCCGGGTGATGTTAATCTG Chr13:81572550..81572569 59.96 50
downstream ENSMUSE00000249073 Chr13:81566602..81566745 CTTCGCTTCCTGGAGAATTG Chr13:81566622..81566641 59.95 50
downstream ENSMUSE00000249066 Chr13:81563222..81563396 TTGATGTCCATGAGCTGGAA Chr13:81563334..81563353 60.2 45
downstream ENSMUSE00000249058 Chr13:81561128..81561263 AGCAGGACTCCCTTCCTCTC Chr13:81561196..81561215 59.95 60
downstream ENSMUSE00000249048 Chr13:81557995..81559097 CACCGTGAAACCCAAAGAGT Chr13:81558942..81558961 60.01 50
downstream ENSMUSE00000249041 Chr13:81553573..81553690 TACTAGGCGCTGGCTGTTTT Chr13:81553571..81553590 60.04 50
downstream ENSMUSE00000249031 Chr13:81552046..81552217 CCACAAACCGGAGTTCATCT Chr13:81552092..81552111 59.97 50
downstream ENSMUSE00000249019 Chr13:81544163..81544405 CCACCTGCAAACTGATCAAA Chr13:81544191..81544210 59.69 45
downstream ENSMUSE00000249007 Chr13:81536166..81536573 CAATTCTGGCACCACCTTTT Chr13:81536338..81536357 59.97 45
downstream ENSMUSE00000248998 Chr13:81530615..81530799 TCTTTGCGCTTTGGGTTAAT Chr13:81530683..81530702 59.72 40
downstream ENSMUSE00000248990 Chr13:81525711..81525960 GGCAACTGTCAAGGATGGTT Chr13:81525913..81525932 59.97 50
downstream ENSMUSE00000248983 Chr13:81524887..81525026 GCAGAGGTTGTGCACTCTGA Chr13:81524962..81524981 60.19 55
downstream ENSMUSE00000248975 Chr13:81521219..81521379 AGTCTGGGCGTAGACAGCAT Chr13:81521255..81521274 59.9 55
downstream ENSMUSE00000248966 Chr13:81513181..81513281 TGAAACAACAGCCAAGCAAA Chr13:81513237..81513256 60.42 40
downstream ENSMUSE00000640942 Chr13:81422355..81422471 GATACAGGTAATGCGCCACA Chr13:81422362..81422381 59.57 50
downstream ENSMUSE00000640940 Chr13:81409743..81409921 GGCATGCTCCGATGATAGAT Chr13:81409751..81409770 60.03 50
downstream ENSMUSE00000248941 Chr13:81321645..81321802 TACCACCACGAGGCACATTA Chr13:81321708..81321727 59.99 50
downstream ENSMUSE00000248936 Chr13:81294154..81294275 CCCAAAGCCACGTCATAGAA Chr13:81294200..81294219 61.02 50
downstream ENSMUSE00000248930 Chr13:81245902..81246090 TCCTGGGTGACCATTCATTT Chr13:81245973..81245992 60.17 45
downstream ENSMUSE00000248923 Chr13:81242218..81242395 TGGGACTCTTCATCGGCTAT Chr13:81242231..81242250 59.65 50
downstream ENSMUSE00000640939 Chr13:81234067..81234500 TGGCTTCCTTGACCAGATTC Chr13:81234433..81234452 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTAATCGCCTTGCAGCAC Chr13:81763076..81763096 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATACAGCATGCAGGCGAAC Chr13:81763169..81763189 61.76 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069170