Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34618
Trapped Gene
C230052I12Rik (ENSMUSG00000030493)
Vector Insertion
Chr 7: 36180255 - 36181828
Public Clones IST14894B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000405158 (Chr7:36181232..36181827 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCCCGACTTCGTGTAGAA Chr7:36181402..36181421 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000405158 (Chr7:36181232..36181827 -)
Downstram Exon
ENSMUSE00000199764 (Chr7:36180256..36180395 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCCCGACTTCGTGTAGAA Chr7:36181402..36181421 60.11 55 AGCGAGCGAGTCTTTTTCTG Chr7:36180242..36180261 59.9 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000405158 Chr7:36181232..36181827 GGTCCCGACTTCGTGTAGAA Chr7:36181402..36181421 60.11 55
upstream ENSMUSE00000199764 Chr7:36180256..36180395 CCTGGCATCAGCAGATTTTT Chr7:36180348..36180367 60.21 45

*** Putative Vector Insertion (Chr 7: 36180255 - 36181828) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000199763 Chr7:36179994..36180146 ACTTCTGGACTGCTGGGAAA Chr7:36180049..36180068 59.84 50
downstream ENSMUSE00000402672 Chr7:36177324..36178110 CACTGGTTAACGGGGACACT Chr7:36177474..36177493 59.88 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCTAGACCCCGGCGTAAT Chr7:36181773..36181793 59.82 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGGTCCACGGAGATTCTA Chr7:36181787..36181807 58.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030493