Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3462
Trapped Gene
Exosc5 (ENSMUSG00000061286)
Vector Insertion
Chr 7: 26444403 - 26448155
Public Clones XQ0142 (sanger) YTC155 (baygenomics) CSD288 (baygenomics) RRZ528 (baygenomics)
CMHD-GT_473B1-3 (cmhd) IST14710B8 (tigm) IST15059D6 (tigm) IST12928A1 (tigm)
Private Clones OST351222 (lexicon) OST292514 (lexicon) OST272165 (lexicon) OST265346 (lexicon)
OST130321 (lexicon) OST119457 (lexicon) OST42648 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000506623 (Chr7:26444221..26444402 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCACTGACACCGGAACAGA Chr7:26444288..26444307 59.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000506623 (Chr7:26444221..26444402 +)
Downstram Exon
ENSMUSE00000508430 (Chr7:26448156..26448269 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCACTGACACCGGAACAGA Chr7:26444288..26444307 59.86 55 GCCTCAGGATCACTTCAAGG Chr7:26448254..26448273 59.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000506623 Chr7:26444221..26444402 CTCACTGACACCGGAACAGA Chr7:26444288..26444307 59.86 55

*** Putative Vector Insertion (Chr 7: 26444403 - 26448155) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000508430 Chr7:26448156..26448269 GCCTCAGGATCACTTCAAGG Chr7:26448254..26448273 59.8 55
downstream ENSMUSE00000511402 Chr7:26449346..26449467 CCCCTAGAACCACAGCTTCA Chr7:26449411..26449430 60.25 55
downstream ENSMUSE00000513713 Chr7:26450440..26450580 GTCCAGCACGAGATTTCCAT Chr7:26450562..26450581 60.08 50
downstream ENSMUSE00000512779 Chr7:26451272..26451361 CGTCAGAATAGAGCCCCTTG Chr7:26451359..26451378 59.83 55
downstream ENSMUSE00000598239 Chr7:26452719..26453041 ATTCCCGGTAGAATCGGAAG Chr7:26452785..26452804 60.28 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACATCGTAGGTGGCCTCT Chr7:26444371..26444391 60.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCACCGAAGAACGTGACTG Chr7:26444442..26444462 59.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061286