Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34631
Trapped Gene
Dpy19l1 (ENSMUSG00000043067)
Vector Insertion
Chr 9: 24292230 - 24318255
Public Clones IST14675B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702310 (Chr9:24318216..24318254 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCCATAAAATGCCACACTC Chr9:24318225..24318244 60.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702310 (Chr9:24318216..24318254 -)
Downstram Exon
ENSMUSE00000702306 (Chr9:24292231..24292358 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCCATAAAATGCCACACTC Chr9:24318225..24318244 60.19 50 CCAAAGGAAATCAGGACTGG Chr9:24292231..24292250 59.52 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702310 Chr9:24318216..24318254 CCCCATAAAATGCCACACTC Chr9:24318225..24318244 60.19 50
upstream ENSMUSE00000702306 Chr9:24292231..24292358 ATGGCTCTGCATCAGCTTCT Chr9:24292294..24292313 60.13 50

*** Putative Vector Insertion (Chr 9: 24292230 - 24318255) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702305 Chr9:24290149..24290173 TGCAATAGAGCTGCAAAGGA Chr9:24290130..24290149 59.71 45
downstream ENSMUSE00000702304 Chr9:24289458..24289545 AATGCCGATCGTTTTCAAAG Chr9:24289486..24289505 60.07 40
downstream ENSMUSE00000702303 Chr9:24286373..24286510 GGGGGTATTCAGTCAGCTTG Chr9:24286392..24286411 59.55 55
downstream ENSMUSE00000702302 Chr9:24282093..24282271 TACCCATGAGCAGACTGTGG Chr9:24282145..24282164 59.7 55
downstream ENSMUSE00000702301 Chr9:24279777..24279897 TCTCCTCGGGTAACTGTCCA Chr9:24279784..24279803 60.65 55
downstream ENSMUSE00000702309 Chr9:24279777..24279901 TGAGTCCTTCTCCTCGGGTA Chr9:24279776..24279795 59.8 55
downstream ENSMUSE00000638149 Chr9:24278218..24278311 GCAACATAAAAGCAAGCAGGA Chr9:24278259..24278279 60.39 42.86
downstream ENSMUSE00000638147 Chr9:24267021..24267078 CCATGATTGAAAAAGAAGCACA Chr9:24267003..24267024 60.11 36.36
downstream ENSMUSE00000638146 Chr9:24258250..24258341 AGAGGTGGCGTCCACATTAC Chr9:24258291..24258310 60 55
downstream ENSMUSE00000638144 Chr9:24255100..24255199 CATGAAGAGCACGTTGGAGA Chr9:24255117..24255136 59.98 50
downstream ENSMUSE00000584822 Chr9:24252231..24252308 CACGGCAAATAATGATGCAA Chr9:24252266..24252285 60.47 40
downstream ENSMUSE00000584821 Chr9:24245199..24245285 CATCGAGTTCCCAAACATCA Chr9:24245219..24245238 59.5 45
downstream ENSMUSE00000584820 Chr9:24243573..24243632 TCTTAGGAACTGGGGCTTCA Chr9:24243578..24243597 59.81 50
downstream ENSMUSE00000584819 Chr9:24243073..24243153 ATCTGCAATGCCAAAGATCC Chr9:24243054..24243073 60.04 45
downstream ENSMUSE00000584818 Chr9:24238783..24238884 CAAACTCGGCTGCACAAGTA Chr9:24238778..24238797 60.05 50
downstream ENSMUSE00000584817 Chr9:24236804..24236875 GAAGCAGCAGTGTCTTCGTG Chr9:24236820..24236839 59.78 55
downstream ENSMUSE00000584804 Chr9:24234875..24234924 TACGACACCCCGCATATCAT Chr9:24234876..24234895 61.14 50
downstream ENSMUSE00000584815 Chr9:24230578..24230602 CTCTCCATGTTCAAATTGTTGTTT Chr9:24230556..24230579 59.45 33.33
downstream ENSMUSE00000584814 Chr9:24229170..24229289 TGTGTGGTGTCAGGAAGAGC Chr9:24229183..24229202 59.87 55
downstream ENSMUSE00000638141 Chr9:24227457..24227631 CCAAAGAGCCATCCAAACAG Chr9:24227590..24227609 60.63 50
downstream ENSMUSE00000638140 Chr9:24226704..24226803 CGGAGAGCAGAGAGCTTCAC Chr9:24226724..24226743 60.43 60
downstream ENSMUSE00000638139 Chr9:24225525..24225650 TGCACCATGACTCTTCCAAA Chr9:24225516..24225535 60.24 45
downstream ENSMUSE00000356036 Chr9:24216493..24218867 GATGTTGCACAGGGGAGTTT Chr9:24218770..24218789 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTCTCCCTGGACTTGTGA Chr9:24294283..24294303 59.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCAGAACCTCCCTATCATT Chr9:24294235..24294256 59.78 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043067