Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34647
Trapped Gene
5033411D12Rik (ENSMUSG00000055137)
Vector Insertion
Chr 13: 17067990 - 17344428
Public Clones (sanger) (sanger) (sanger) IST13158H10 (tigm) IST14454D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000469948 (Chr13:17344325..17344427 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAAGTGGCTTTGTCTCTT Chr13:17344389..17344408 59.48 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000469948 (Chr13:17344325..17344427 -)
Downstram Exon
ENSMUSE00000520278 (Chr13:17067991..17068054 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAAGTGGCTTTGTCTCTT Chr13:17344389..17344408 59.48 50 TTCCCCACAGTTGGATGATT Chr13:17067983..17068002 60.17 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447092 Chr13:17786473..17786566 No primer for this exon
upstream ENSMUSE00000447061 Chr13:17764385..17764436 GACAGTATGAAGCCCCTGGA Chr13:17764412..17764431 60.07 55
upstream ENSMUSE00000447054 Chr13:17763535..17763608 TTGCCACGATGAATTTAGGA Chr13:17763572..17763591 59.11 40
upstream ENSMUSE00000447048 Chr13:17754573..17754658 GGGGACCTCCTTTTGTGAAC Chr13:17754615..17754634 60.72 55
upstream ENSMUSE00000447042 Chr13:17754053..17754103 TCAAGGATCCAAGAGGAGTGA Chr13:17754067..17754087 59.79 47.62
upstream ENSMUSE00000447037 Chr13:17736615..17736735 CTTGCAGCCATTTGTGATGT Chr13:17736716..17736735 59.72 45
upstream ENSMUSE00000447033 Chr13:17669324..17669415 No primer for this exon
upstream ENSMUSE00000447030 Chr13:17646160..17646303 ATTATGGCTGGCCTCCTACA Chr13:17646215..17646234 59.55 50
upstream ENSMUSE00000447078 Chr13:17544291..17544386 TGGCATGTTTGACCCAAGTA Chr13:17544366..17544385 59.96 45
upstream ENSMUSE00000325500 Chr13:17415039..17415110 No primer for this exon
upstream ENSMUSE00000361661 Chr13:17393752..17393849 GAACGAACCATCTTCGGGTA Chr13:17393790..17393809 59.93 50
upstream ENSMUSE00000469948 Chr13:17344325..17344427 GCCAAGTGGCTTTGTCTCTT Chr13:17344389..17344408 59.48 50
upstream ENSMUSE00000520278 Chr13:17067991..17068054 TGCACAATGGCCTTGTTATG Chr13:17068031..17068050 60.52 45

*** Putative Vector Insertion (Chr 13: 17067990 - 17344428) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000618096 Chr13:16949689..16949852 TCTCAATAGCCCCCTCATCA Chr13:16949711..16949730 60.56 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTAATCGCCTTGCAGCAC Chr13:17206360..17206380 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAACGTGACTGGGAAAAC Chr13:17206362..17206382 58.6 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055137