Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34667
Trapped Gene
Yeats2 (ENSMUSG00000041215)
Vector Insertion
Chr 16: 20159326 - 20162048
Public Clones IST10442F3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000268724 (Chr16:20159210..20159325 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAACGGGAACTACGGAATG Chr16:20159236..20159255 60.36 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000268724 (Chr16:20159210..20159325 +)
Downstram Exon
ENSMUSE00000268716 (Chr16:20162049..20162210 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAACGGGAACTACGGAATG Chr16:20159236..20159255 60.36 50 CTTCCCGCTTATCTGGAGGT Chr16:20162077..20162096 60.59 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000620887 Chr16:20141181..20141308 GGAGGAGACCTTTCGCTCTT Chr16:20141227..20141246 59.96 55
upstream ENSMUSE00000268659 Chr16:20150534..20150633 TGGAATCAAGCGAACAATCA Chr16:20150539..20150558 60.2 40
upstream ENSMUSE00000268650 Chr16:20152982..20153079 GCAGCTGTGCAGAAAATTGA Chr16:20152990..20153009 60.14 45
upstream ENSMUSE00000561643 Chr16:20152982..20153079 GCAGCTGTGCAGAAAATTGA Chr16:20152990..20153009 60.14 45
upstream ENSMUSE00000268743 Chr16:20154210..20154302 GGCCTGCATTGTAGCAAACT Chr16:20154248..20154267 60.28 50
upstream ENSMUSE00000268731 Chr16:20156960..20157205 TCCGATGGCTTTTAATCACC Chr16:20156977..20156996 59.9 45
upstream ENSMUSE00000268724 Chr16:20159210..20159325 CAAACGGGAACTACGGAATG Chr16:20159236..20159255 60.36 50

*** Putative Vector Insertion (Chr 16: 20159326 - 20162048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000268716 Chr16:20162049..20162210 CTTCCCGCTTATCTGGAGGT Chr16:20162077..20162096 60.59 55
downstream ENSMUSE00000268644 Chr16:20171264..20171375 GAAACTCACCCCAGCCTCTT Chr16:20171310..20171329 60.63 55
downstream ENSMUSE00000268638 Chr16:20174568..20174612 CAGGGTCTGTAGGCCAGTGT Chr16:20174603..20174622 60.17 60
downstream ENSMUSE00000268632 Chr16:20179574..20179748 AGTCTTCACCAAGCGAGTGC Chr16:20179619..20179638 60.6 55
downstream ENSMUSE00000268624 Chr16:20186324..20186563 TTTGCAGCTTGATGCGATAG Chr16:20186481..20186500 60.12 45
downstream ENSMUSE00000268619 Chr16:20189412..20189570 TGTGCGAGGTAATGGTGATG Chr16:20189458..20189477 60.54 50
downstream ENSMUSE00000645049 Chr16:20190459..20190562 ATAGGGGACCCTGTTCCTTG Chr16:20190522..20190541 60.18 55
downstream ENSMUSE00000645048 Chr16:20193232..20193339 GGCTCTGCACTTTAGGGTGA Chr16:20193304..20193323 60.4 55
downstream ENSMUSE00000645047 Chr16:20193717..20193899 GGGTGCAATCTTTGGTGACT Chr16:20193896..20193915 59.97 50
downstream ENSMUSE00000645046 Chr16:20203728..20203986 CTCCACCTCCACTCACGATT Chr16:20203902..20203921 60.11 55
downstream ENSMUSE00000645045 Chr16:20206157..20206318 GTAGTTGCAAGGTGGCCATT Chr16:20206180..20206199 60 50
downstream ENSMUSE00000645044 Chr16:20207697..20207866 GGGGTTTGCTTGAGGATGTA Chr16:20207865..20207884 59.93 50
downstream ENSMUSE00000645043 Chr16:20208492..20208650 CTTGAACCACCGATGCAGTA Chr16:20208567..20208586 59.72 50
downstream ENSMUSE00000645042 Chr16:20210105..20210281 CATTTGCTGAGAAGGCCACT Chr16:20210270..20210289 60.4 50
downstream ENSMUSE00000645041 Chr16:20211642..20211822 GATGACACAGGGGTTGATCC Chr16:20211670..20211689 60.18 55
downstream ENSMUSE00000645039 Chr16:20213340..20213468 CAGGCATCAAGACAGTCTGC Chr16:20213462..20213481 59.58 55
downstream ENSMUSE00000645036 Chr16:20214464..20214565 GGAACACTTATGGGCAGGAC Chr16:20214524..20214543 59.41 55
downstream ENSMUSE00000645034 Chr16:20218457..20218559 AGTTTGGCCCAGGAGTTTCT Chr16:20218492..20218511 60.11 50
downstream ENSMUSE00000645033 Chr16:20219691..20219764 CTGCTGGATGGTCTCCAAAT Chr16:20219721..20219740 60.07 50
downstream ENSMUSE00000645032 Chr16:20221747..20221826 GGACTTCGCAGAAAAACAGC Chr16:20221781..20221800 60 50
downstream ENSMUSE00000645031 Chr16:20222813..20223014 CTTGGTCTTGAGGGGAGTCA Chr16:20222905..20222924 60.23 55
downstream ENSMUSE00000268533 Chr16:20227786..20228012 TCCCTTTTCTGGAACTGCTG Chr16:20227864..20227883 60.37 50
downstream ENSMUSE00000471864 Chr16:20227786..20227913 TCCCTTTTCTGGAACTGCTG Chr16:20227864..20227883 60.37 50
downstream ENSMUSE00000268527 Chr16:20228770..20228844 No primer for this exon
downstream ENSMUSE00000268521 Chr16:20229571..20229644 GTTGGGAGATGCTGTCTGGT Chr16:20229645..20229664 60.12 55
downstream ENSMUSE00000492268 Chr16:20230838..20232646 CAGCTCTCAGGTACGGAAGG Chr16:20232128..20232147 60.01 60
downstream ENSMUSE00000561639 Chr16:20231941..20232347 GCACGGTAGATCCCTTGGTA Chr16:20232152..20232171 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGATAGTAGTCGGCAACGTG Chr16:20159302..20159322 59.37 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGATAGTAGTCGGCAACGTG Chr16:20159302..20159322 59.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041215