Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34676
Trapped Gene
Gpc5 (ENSMUSG00000022112)
Vector Insertion
Chr 14: 115532531 - 115768752
Public Clones (sanger) (sanger) IST11390H8 (tigm) IST12229A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000472170 (Chr14:115532369..115532530 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAACCCAACGTGCTGTACC Chr14:115532396..115532415 59.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000472170 (Chr14:115532369..115532530 +)
Downstram Exon
ENSMUSE00000685146 (Chr14:115768753..115769448 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAACCCAACGTGCTGTACC Chr14:115532396..115532415 59.9 50 CCCCATACAGGGCTTACTGA Chr14:115769247..115769266 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000473073 Chr14:115491848..115492010 CTGCGAAGAAGTTCGGAAAC Chr14:115491934..115491953 59.99 50
upstream ENSMUSE00000472170 Chr14:115532369..115532530 AAAACCCAACGTGCTGTACC Chr14:115532396..115532415 59.9 50

*** Putative Vector Insertion (Chr 14: 115532531 - 115768752) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000685146 Chr14:115768753..115769448 CCCCATACAGGGCTTACTGA Chr14:115769247..115769266 59.95 55
downstream ENSMUSE00000418620 Chr14:115768754..115769448 CCCCATACAGGGCTTACTGA Chr14:115769247..115769266 59.95 55
downstream ENSMUSE00000418605 Chr14:115798368..115798501 TGGCCACAAATCGTATTCAC Chr14:115798390..115798409 59.4 45
downstream ENSMUSE00000552710 Chr14:115816365..115816488 GCATGCTTCTCTGCAGTACG Chr14:115816397..115816416 59.77 55
downstream ENSMUSE00000123709 Chr14:115827361..115827486 GGGCAGCCAATTCATTAACA Chr14:115827446..115827465 60.84 45
downstream ENSMUSE00000468040 Chr14:115951437..115951557 CAACCACACGCTGAGCATAG Chr14:115951459..115951478 60.47 55
downstream ENSMUSE00000474857 Chr14:116187395..116187554 GAAGGAGCTCCCACTTGTTG Chr14:116187443..116187462 59.84 55
downstream ENSMUSE00000466876 Chr14:116923502..116923659 GACTCAGTTCCTGACGCACA Chr14:116923610..116923629 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCCCTATCTGTGTCACCA Chr14:115622518..115622538 60.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGACATGGACCGTGACTGG Chr14:115622571..115622591 60.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022112