Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34678
Trapped Gene
Trpc6 (ENSMUSG00000031997)
Vector Insertion
Chr 9: 8658378 - 8677923
Public Clones PST19651-NL (escells) IST13806B11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000215573 (Chr9:8658303..8658377 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGAATTTCAGGAAGTCACG Chr9:8658322..8658342 60.1 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000215573 (Chr9:8658303..8658377 +)
Downstram Exon
ENSMUSE00000215580 (Chr9:8677924..8678007 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGAATTTCAGGAAGTCACG Chr9:8658322..8658342 60.1 42.86 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000400265 Chr9:8544142..8544598 GCAGAACCTAGCCAGTCAGG Chr9:8544278..8544297 60.01 60
upstream ENSMUSE00000502783 Chr9:8609700..8610474 GGTGCGGAAGATGCTAGAAG Chr9:8609868..8609887 59.98 55
upstream ENSMUSE00000215577 Chr9:8626593..8626775 GCAAGGATTTCGTTGTTGGT Chr9:8626621..8626640 59.98 45
upstream ENSMUSE00000215575 Chr9:8634047..8634211 GCAGTGAAGTTCCTCGTGGT Chr9:8634128..8634147 60.31 55
upstream ENSMUSE00000215583 Chr9:8643506..8643722 CCTCCCTAATGAAACCAGCA Chr9:8643622..8643641 60.07 50
upstream ENSMUSE00000215579 Chr9:8649298..8649531 AAGTCACACTGGGGGACAAC Chr9:8649493..8649512 59.86 55
upstream ENSMUSE00000539830 Chr9:8652936..8653200 TCTTTATGCAATCGCTGTGG Chr9:8652982..8653001 59.83 45
upstream ENSMUSE00000301131 Chr9:8655177..8655372 CGGCTACGTTCTGTATGGTG Chr9:8655276..8655295 59.22 55
upstream ENSMUSE00000215574 Chr9:8656542..8656745 GAGCTCATCCAGGGTCAAAA Chr9:8656692..8656711 60.19 50
upstream ENSMUSE00000215573 Chr9:8658303..8658377 TTGGAATTTCAGGAAGTCACG Chr9:8658322..8658342 60.1 42.86

*** Putative Vector Insertion (Chr 9: 8658378 - 8677923) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215580 Chr9:8677924..8678007 No primer for this exon
downstream ENSMUSE00000215582 Chr9:8679468..8679543 ATCAATCTGGGCCTGCAATA Chr9:8679521..8679540 60.44 45
downstream ENSMUSE00000454306 Chr9:8680414..8680741 CCAGCTTTGGCTCTAACGAC Chr9:8680551..8680570 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGGAGCTCACAAAGCAC Chr9:8661356..8661376 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCAGGAAGTCACGAAGACC Chr9:8661329..8661350 59.32 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031997