Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34686
Trapped Gene
Hs2st1 (ENSMUSG00000040151)
Vector Insertion
Chr 3: 144100558 - 144110373
Public Clones IST11204A2 (tigm) IST11442E1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000270703 (Chr3:144110234..144110372 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGAGACGGAAACAAGGAGA Chr3:144110241..144110260 58.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000270703 (Chr3:144110234..144110372 -)
Downstram Exon
ENSMUSE00000270691 (Chr3:144100559..144100656 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGAGACGGAAACAAGGAGA Chr3:144110241..144110260 58.87 50 CAGAGCTTCTCTGGAGCACA Chr3:144100579..144100598 59.44 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000492150 Chr3:144232698..144233103 ATGGGGCTCCTCAGGATTAT Chr3:144232802..144232821 59.75 50
upstream ENSMUSE00000669042 Chr3:144128728..144128752 No primer for this exon
upstream ENSMUSE00000373159 Chr3:144128011..144128249 CAGGATGCAACTCTGGATGA Chr3:144128165..144128184 59.79 50
upstream ENSMUSE00000270714 Chr3:144116916..144117001 ACCACCTGGAACGAGATGAA Chr3:144116961..144116980 60.51 50
upstream ENSMUSE00000270703 Chr3:144110234..144110372 AGGAGACGGAAACAAGGAGA Chr3:144110241..144110260 58.87 50
upstream ENSMUSE00000270691 Chr3:144100559..144100656 CAGATCCCGTTCTTCTGTGG Chr3:144100577..144100596 60.65 55

*** Putative Vector Insertion (Chr 3: 144100558 - 144110373) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000270681 Chr3:144098426..144098583 TCGAGCAGCATGATGAAGTC Chr3:144098454..144098473 60.1 50
downstream ENSMUSE00000478936 Chr3:144094079..144097678 GAATCCATTCGCTCCAAAAA Chr3:144094855..144094874 60.02 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGCATTCTGCTCTTTCAG Chr3:144101371..144101391 58.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGCTGGCCTCATGTAAC Chr3:144101338..144101358 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040151