Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34726
Trapped Gene
Lrrc16a (ENSMUSG00000021338)
Vector Insertion
Chr 13: 24104529 - 24111580
Public Clones IST13417D1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000451254 (Chr13:24111433..24111579 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000451254 (Chr13:24111433..24111579 -)
Downstram Exon
ENSMUSE00000358292 (Chr13:24104530..24105329 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000717545 Chr13:24372430..24372664 No primer for this exon
upstream ENSMUSE00000719752 Chr13:24372430..24372664 No primer for this exon
upstream ENSMUSE00000720586 Chr13:24372430..24372664 No primer for this exon
upstream ENSMUSE00000413275 Chr13:24368326..24368423 No primer for this exon
upstream ENSMUSE00000683813 Chr13:24368326..24368423 No primer for this exon
upstream ENSMUSE00000370559 Chr13:24270076..24270126 No primer for this exon
upstream ENSMUSE00000683811 Chr13:24270076..24270126 No primer for this exon
upstream ENSMUSE00000413785 Chr13:24265485..24265544 No primer for this exon
upstream ENSMUSE00000683809 Chr13:24265485..24265544 No primer for this exon
upstream ENSMUSE00000337149 Chr13:24256670..24256791 No primer for this exon
upstream ENSMUSE00000683808 Chr13:24256670..24256791 No primer for this exon
upstream ENSMUSE00000380434 Chr13:24247259..24247356 No primer for this exon
upstream ENSMUSE00000683806 Chr13:24247259..24247356 No primer for this exon
upstream ENSMUSE00000399014 Chr13:24246853..24246923 No primer for this exon
upstream ENSMUSE00000710224 Chr13:24246853..24246923 No primer for this exon
upstream ENSMUSE00000716362 Chr13:24246853..24246923 No primer for this exon
upstream ENSMUSE00000355440 Chr13:24246547..24246620 No primer for this exon
upstream ENSMUSE00000683804 Chr13:24246547..24246620 No primer for this exon
upstream ENSMUSE00000571498 Chr13:24233525..24233600 No primer for this exon
upstream ENSMUSE00000683803 Chr13:24233525..24233600 No primer for this exon
upstream ENSMUSE00000571497 Chr13:24231158..24231246 No primer for this exon
upstream ENSMUSE00000683802 Chr13:24231158..24231246 No primer for this exon
upstream ENSMUSE00000571496 Chr13:24229006..24229100 No primer for this exon
upstream ENSMUSE00000683801 Chr13:24229006..24229100 No primer for this exon
upstream ENSMUSE00000571495 Chr13:24213708..24213794 No primer for this exon
upstream ENSMUSE00000683800 Chr13:24213708..24213794 No primer for this exon
upstream ENSMUSE00000571494 Chr13:24207344..24207447 No primer for this exon
upstream ENSMUSE00000683799 Chr13:24207344..24207447 No primer for this exon
upstream ENSMUSE00000683777 Chr13:24204667..24204690 No primer for this exon
upstream ENSMUSE00000571493 Chr13:24203883..24203960 No primer for this exon
upstream ENSMUSE00000683798 Chr13:24203883..24203960 No primer for this exon
upstream ENSMUSE00000571492 Chr13:24203679..24203755 No primer for this exon
upstream ENSMUSE00000683797 Chr13:24203679..24203755 No primer for this exon
upstream ENSMUSE00000617415 Chr13:24200359..24200463 No primer for this exon
upstream ENSMUSE00000708933 Chr13:24200359..24200463 No primer for this exon
upstream ENSMUSE00000718741 Chr13:24200359..24200463 No primer for this exon
upstream ENSMUSE00000617391 Chr13:24198178..24198247 No primer for this exon
upstream ENSMUSE00000617414 Chr13:24198178..24198247 No primer for this exon
upstream ENSMUSE00000643071 Chr13:24193941..24193952 No primer for this exon
upstream ENSMUSE00000683869 Chr13:24193941..24193952 No primer for this exon
upstream ENSMUSE00000683772 Chr13:24191492..24191532 No primer for this exon
upstream ENSMUSE00000617412 Chr13:24191451..24191532 No primer for this exon
upstream ENSMUSE00000708692 Chr13:24191451..24191532 No primer for this exon
upstream ENSMUSE00000716302 Chr13:24191451..24191532 No primer for this exon
upstream ENSMUSE00000617388 Chr13:24190830..24190929 No primer for this exon
upstream ENSMUSE00000709096 Chr13:24190830..24190929 No primer for this exon
upstream ENSMUSE00000710555 Chr13:24190830..24190929 No primer for this exon
upstream ENSMUSE00000643068 Chr13:24190675..24190729 No primer for this exon
upstream ENSMUSE00000683789 Chr13:24190675..24190729 No primer for this exon
upstream ENSMUSE00000643067 Chr13:24186267..24186439 No primer for this exon
upstream ENSMUSE00000683786 Chr13:24186267..24186439 No primer for this exon
upstream ENSMUSE00000683859 Chr13:24186267..24186302 No primer for this exon
upstream ENSMUSE00000643065 Chr13:24184375..24184443 No primer for this exon
upstream ENSMUSE00000683857 Chr13:24184375..24184443 No primer for this exon
upstream ENSMUSE00000643062 Chr13:24180847..24180940 No primer for this exon
upstream ENSMUSE00000683854 Chr13:24180847..24180940 No primer for this exon
upstream ENSMUSE00000643060 Chr13:24173798..24173896 No primer for this exon
upstream ENSMUSE00000683852 Chr13:24173798..24173896 No primer for this exon
upstream ENSMUSE00000643058 Chr13:24167481..24167609 No primer for this exon
upstream ENSMUSE00000683850 Chr13:24167481..24167609 No primer for this exon
upstream ENSMUSE00000643057 Chr13:24165809..24165940 No primer for this exon
upstream ENSMUSE00000683848 Chr13:24165809..24165940 No primer for this exon
upstream ENSMUSE00000643055 Chr13:24161500..24161675 No primer for this exon
upstream ENSMUSE00000683846 Chr13:24161500..24161675 No primer for this exon
upstream ENSMUSE00000643053 Chr13:24159001..24159088 No primer for this exon
upstream ENSMUSE00000683843 Chr13:24159001..24159088 No primer for this exon
upstream ENSMUSE00000643052 Chr13:24156446..24156595 No primer for this exon
upstream ENSMUSE00000683841 Chr13:24156446..24156595 No primer for this exon
upstream ENSMUSE00000643050 Chr13:24141512..24141529 No primer for this exon
upstream ENSMUSE00000643049 Chr13:24136885..24136951 No primer for this exon
upstream ENSMUSE00000683838 Chr13:24136885..24136951 No primer for this exon
upstream ENSMUSE00000643046 Chr13:24136043..24136239 No primer for this exon
upstream ENSMUSE00000683836 Chr13:24136043..24136239 No primer for this exon
upstream ENSMUSE00000643045 Chr13:24133542..24133654 No primer for this exon
upstream ENSMUSE00000683833 Chr13:24133542..24133654 No primer for this exon
upstream ENSMUSE00000643044 Chr13:24128054..24128477 No primer for this exon
upstream ENSMUSE00000683830 Chr13:24128054..24128477 No primer for this exon
upstream ENSMUSE00000643043 Chr13:24117723..24117804 No primer for this exon
upstream ENSMUSE00000683827 Chr13:24117723..24117804 No primer for this exon
upstream ENSMUSE00000643042 Chr13:24116192..24116404 No primer for this exon
upstream ENSMUSE00000709462 Chr13:24116192..24116404 No primer for this exon
upstream ENSMUSE00000712280 Chr13:24116192..24116404 No primer for this exon
upstream ENSMUSE00000714721 Chr13:24116192..24116404 No primer for this exon
upstream ENSMUSE00000391954 Chr13:24114365..24114505 No primer for this exon
upstream ENSMUSE00000643041 Chr13:24114365..24114505 No primer for this exon
upstream ENSMUSE00000683781 Chr13:24114365..24114505 No primer for this exon
upstream ENSMUSE00000683795 Chr13:24111921..24111940 No primer for this exon
upstream ENSMUSE00000451094 Chr13:24111916..24111940 No primer for this exon
upstream ENSMUSE00000451254 Chr13:24111433..24111579 No primer for this exon
upstream ENSMUSE00000358292 Chr13:24104530..24105329 No primer for this exon
upstream ENSMUSE00000481751 Chr13:24104530..24105329 No primer for this exon

*** Putative Vector Insertion (Chr 13: 24104529 - 24111580) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000478715 Chr13:24104528..24105329 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTCCACTTCACATCCACA Chr13:24108562..24108582 60.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTCCACTTCACATCCACA Chr13:24108562..24108582 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021338