Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34728
Trapped Gene
Ceacam2 (ENSMUSG00000054385)
Vector Insertion
Chr 7: 26301061 - 26304210
Public Clones IST14925F8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636358 (Chr7:26304178..26304209 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636358 (Chr7:26304178..26304209 -)
Downstram Exon
ENSMUSE00000636354 (Chr7:26301062..26303204 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGAGGGTGTGCCTTAGCTC Chr7:26301281..26301300 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636359 Chr7:26324720..26324806 TCCCTGGTTTGGACTACTGC Chr7:26324726..26324745 60.11 55
upstream ENSMUSE00000461821 Chr7:26323593..26323952 AAGGGAGTCTCGGCCTTTAG Chr7:26323820..26323839 59.84 55
upstream ENSMUSE00000460573 Chr7:26315490..26315774 AACCGAAGTGACCCATTCAG Chr7:26315504..26315523 59.97 50
upstream ENSMUSE00000462771 Chr7:26314769..26315023 CGGAACCTATACCTGCTTCG Chr7:26314826..26314845 59.72 55
upstream ENSMUSE00000199496 Chr7:26312760..26313035 CGGCGAGTATCAGTGTGAAA Chr7:26312814..26312833 59.86 50
upstream ENSMUSE00000199486 Chr7:26305833..26305950 ATTTCAGATGTCCCCATTGC Chr7:26305914..26305933 59.76 45
upstream ENSMUSE00000598264 Chr7:26304982..26305034 GCGAGATCTCACAGAGCACA Chr7:26305003..26305022 60.3 55
upstream ENSMUSE00000636355 Chr7:26304178..26304209 No primer for this exon
upstream ENSMUSE00000636358 Chr7:26304178..26304209 No primer for this exon
upstream ENSMUSE00000598262 Chr7:26301062..26303204 GAGCTAAGGCACACCCTCTG Chr7:26301303..26301322 60.01 60
upstream ENSMUSE00000636354 Chr7:26301062..26303204 GAGCTAAGGCACACCCTCTG Chr7:26301303..26301322 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTGCTTCACCCATAATCG Chr7:26301153..26301173 58.62 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAACAGGCTTTGGAGAGAA Chr7:26301228..26301248 60.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054385