Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34729
Trapped Gene
Ceacam1 (ENSMUSG00000074272)
Vector Insertion
Chr 7: 26251335 - 26257093
Public Clones IST13411C11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636437 (Chr7:26256817..26257092 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGACCTGCTTGTCGAATGA Chr7:26257008..26257027 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636437 (Chr7:26256817..26257092 -)
Downstram Exon
ENSMUSE00000636404 (Chr7:26251336..26251456 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGACCTGCTTGTCGAATGA Chr7:26257008..26257027 59.98 50 CCACAACTCCAATCACGATG Chr7:26251372..26251391 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000475696 Chr7:26262490..26262644 TCAGCACATCTCCACAAAGG Chr7:26262522..26262541 59.83 50
upstream ENSMUSE00000636443 Chr7:26261363..26261722 GGATCCCTGCTCTTCCAAAT Chr7:26261455..26261474 60.41 50
upstream ENSMUSE00000636408 Chr7:26259539..26259823 ATGTGTGTGAAACCCGGAAT Chr7:26259585..26259604 60.1 45
upstream ENSMUSE00000463363 Chr7:26258817..26259071 CGGAACCTATACCTGCTTCG Chr7:26258874..26258893 59.72 55
upstream ENSMUSE00000636437 Chr7:26256817..26257092 CTGACCTGCTTGTCGAATGA Chr7:26257008..26257027 59.98 50
upstream ENSMUSE00000636404 Chr7:26251336..26251456 CATCGTGATTGGAGTTGTGG Chr7:26251394..26251413 59.96 50

*** Putative Vector Insertion (Chr 7: 26251335 - 26257093) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636399 Chr7:26250487..26250539 TGTGAGATCTCGCTGGTCAC Chr7:26250493..26250512 59.99 55
downstream ENSMUSE00000636428 Chr7:26250487..26250539 TGTGAGATCTCGCTGGTCAC Chr7:26250493..26250512 59.99 55
downstream ENSMUSE00000636396 Chr7:26249868..26249899 No primer for this exon
downstream ENSMUSE00000636423 Chr7:26249868..26249899 No primer for this exon
downstream ENSMUSE00000676633 Chr7:26249868..26249899 No primer for this exon
downstream ENSMUSE00000514051 Chr7:26246721..26248919 CAGAGGGTGTGCCTTAGCTC Chr7:26246946..26246965 60.01 60
downstream ENSMUSE00000535853 Chr7:26246721..26248919 CAGAGGGTGTGCCTTAGCTC Chr7:26246946..26246965 60.01 60
downstream ENSMUSE00000636393 Chr7:26246721..26248919 CAGAGGGTGTGCCTTAGCTC Chr7:26246946..26246965 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000074272