Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34740
Trapped Gene
AC154553.3 (ENSMUSG00000023943)
Vector Insertion
Chr 17: 54113226 - 54129957
Public Clones IST13968F4 (tigm) IST13968F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136545 (Chr17:54129840..54129956 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCGGTCCTCACCTGACATC Chr17:54129842..54129861 59.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136545 (Chr17:54129840..54129956 -)
Downstram Exon
ENSMUSE00000136546 (Chr17:54113227..54113422 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCGGTCCTCACCTGACATC Chr17:54129842..54129861 59.93 55 CTGTTCATCGAGGTGGAGGT Chr17:54113335..54113354 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000136545 Chr17:54129840..54129956 ATCGGTCCTCACCTGACATC Chr17:54129842..54129861 59.93 55
upstream ENSMUSE00000136546 Chr17:54113227..54113422 ACCTCCACCTCGATGAACAG Chr17:54113357..54113376 60.11 55

*** Putative Vector Insertion (Chr 17: 54113226 - 54129957) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136543 Chr17:54111311..54111439 TCCACAATTTCCTGTGTCCA Chr17:54111390..54111409 59.94 45
downstream ENSMUSE00000136542 Chr17:54108958..54109055 GCATTTGAACAGGCAGATGA Chr17:54108968..54108987 59.81 45
downstream ENSMUSE00000136540 Chr17:54103957..54104083 AGGGTCAGGCAGCATTTTATT Chr17:54103978..54103998 59.98 42.86
downstream ENSMUSE00000136537 Chr17:54103306..54103400 CCACCATCCCTTTACATGGT Chr17:54103338..54103357 59.53 50
downstream ENSMUSE00000136544 Chr17:54101722..54101902 CCATTGGGTTCTGCTTCATT Chr17:54101763..54101782 59.93 45
downstream ENSMUSE00000397979 Chr17:54100941..54101509 TTCCGTTTATTTTGCCCAAG Chr17:54101155..54101174 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr17:54117889..54117909 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACGTGACTGGGAAAACC Chr17:54117890..54117910 60.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023943