Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34748
Trapped Gene
Gnas (ENSMUSG00000027523)
Vector Insertion
Chr 2: 174110979 - 174113991
Public Clones (sanger) (sanger) IST14389G6 (tigm) IST14389G6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716134 (Chr2:174110105..174110978 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACGAGACCGAGACCGATTC Chr2:174110505..174110524 60.22 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716134 (Chr2:174110105..174110978 +)
Downstram Exon
ENSMUSE00000679010 (Chr2:174113992..174114087 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACGAGACCGAGACCGATTC Chr2:174110505..174110524 60.22 55 TCTCGTTAAGGGGACACAGC Chr2:174114070..174114089 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000493074 Chr2:174109821..174110009 TCCCAGACGAGAGGATCAGT Chr2:174109837..174109856 59.79 55
upstream ENSMUSE00000548728 Chr2:174110105..174110978 TACGAGACCGAGACCGATTC Chr2:174110505..174110524 60.22 55
upstream ENSMUSE00000716134 Chr2:174110105..174110978 TACGAGACCGAGACCGATTC Chr2:174110505..174110524 60.22 55
upstream ENSMUSE00000706046 Chr2:174110936..174110978 TGACTCCGTCCAGATTCTCC Chr2:174110941..174110960 60.2 55

*** Putative Vector Insertion (Chr 2: 174110979 - 174113991) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679010 Chr2:174113992..174114087 TCTCGTTAAGGGGACACAGC Chr2:174114070..174114089 60.26 55
downstream ENSMUSE00000679009 Chr2:174121497..174122396 CGGACATTTTGCCAGTAGGT Chr2:174121592..174121611 59.99 50
downstream ENSMUSE00000708430 Chr2:174123360..174125718 CTCCAGTTGCTTGTCGATGA Chr2:174125675..174125694 59.98 50
downstream ENSMUSE00000713635 Chr2:174123360..174125718 CTCCAGTTGCTTGTCGATGA Chr2:174125675..174125694 59.98 50
downstream ENSMUSE00000678997 Chr2:174123363..174125718 CTCCAGTTGCTTGTCGATGA Chr2:174125675..174125694 59.98 50
downstream ENSMUSE00000548461 Chr2:174125932..174126303 AGTGCCTGGGATGGATACTG Chr2:174126245..174126264 59.95 55
downstream ENSMUSE00000678996 Chr2:174125932..174126026 No primer for this exon
downstream ENSMUSE00000592009 Chr2:174153269..174153442 GTACCAGCCACCTGAAGCAA Chr2:174153305..174153324 61.24 55
downstream ENSMUSE00000548443 Chr2:174153609..174155935 AGCAAGAAACCGAAAAGCAA Chr2:174153784..174153803 60 40
downstream ENSMUSE00000678985 Chr2:174155507..174155935 GCTGGTCCTCGGTCTTACTG Chr2:174155836..174155855 59.87 60
downstream ENSMUSE00000678991 Chr2:174155590..174155935 GCTGGTCCTCGGTCTTACTG Chr2:174155836..174155855 59.87 60
downstream ENSMUSE00000678983 Chr2:174155598..174155935 GCTGGTCCTCGGTCTTACTG Chr2:174155836..174155855 59.87 60
downstream ENSMUSE00000678979 Chr2:174155788..174155935 GCTGGTCCTCGGTCTTACTG Chr2:174155836..174155855 59.87 60
downstream ENSMUSE00000548573 Chr2:174159713..174159785 GGTGCTTTTGCCAGACTCTC Chr2:174159741..174159760 60 55
downstream ENSMUSE00000638806 Chr2:174159713..174159785 GGTGCTTTTGCCAGACTCTC Chr2:174159741..174159760 60 55
downstream ENSMUSE00000678995 Chr2:174159713..174159785 GGTGCTTTTGCCAGACTCTC Chr2:174159741..174159760 60 55
downstream ENSMUSE00000592010 Chr2:174162248..174162292 ATCGCTGTTGCTCCTTGCAG Chr2:174162293..174162312 63.9 55
downstream ENSMUSE00000638805 Chr2:174162248..174162292 ATCGCTGTTGCTCCTTGCAG Chr2:174162293..174162312 63.9 55
downstream ENSMUSE00000555753 Chr2:174163122..174163585 TGGGGTAGGACATAGCGAAG Chr2:174163184..174163203 60.09 55
downstream ENSMUSE00000678978 Chr2:174163122..174163585 TGGGGTAGGACATAGCGAAG Chr2:174163184..174163203 60.09 55
downstream ENSMUSE00000473367 Chr2:174167151..174167208 CCTGCACTTTAGTGGCCTTC Chr2:174167179..174167198 59.88 55
downstream ENSMUSE00000638804 Chr2:174167154..174167208 CCTGCACTTTAGTGGCCTTC Chr2:174167179..174167198 59.88 55
downstream ENSMUSE00000679026 Chr2:174167154..174167208 CCTGCACTTTAGTGGCCTTC Chr2:174167179..174167198 59.88 55
downstream ENSMUSE00000638803 Chr2:174167311..174167430 CGTTCATCACGCTCAGAATG Chr2:174167410..174167429 60.41 50
downstream ENSMUSE00000679025 Chr2:174167311..174167430 CGTTCATCACGCTCAGAATG Chr2:174167410..174167429 60.41 50
downstream ENSMUSE00000638802 Chr2:174168701..174168798 ACTGGGCACAGTCAATCAGC Chr2:174168800..174168819 61.29 55
downstream ENSMUSE00000679022 Chr2:174168701..174168798 ACTGGGCACAGTCAATCAGC Chr2:174168800..174168819 61.29 55
downstream ENSMUSE00000470732 Chr2:174170576..174170630 TGGTCACTTGGCACGTAGTC Chr2:174170632..174170651 59.75 55
downstream ENSMUSE00000638801 Chr2:174170576..174170630 TGGTCACTTGGCACGTAGTC Chr2:174170632..174170651 59.75 55
downstream ENSMUSE00000638800 Chr2:174170729..174170802 ATTCCAGAGGTCAGGACACG Chr2:174170766..174170785 60.11 55
downstream ENSMUSE00000679020 Chr2:174170729..174170802 ATTCCAGAGGTCAGGACACG Chr2:174170766..174170785 60.11 55
downstream ENSMUSE00000638799 Chr2:174170884..174171063 CAGGCGGTTAGTCTGGTTGT Chr2:174171025..174171044 60.17 55
downstream ENSMUSE00000679018 Chr2:174170884..174171063 CAGGCGGTTAGTCTGGTTGT Chr2:174171025..174171044 60.17 55
downstream ENSMUSE00000638798 Chr2:174171150..174171280 AGTGGTGTAGCGAGCGAACT Chr2:174171273..174171292 60.08 55
downstream ENSMUSE00000679017 Chr2:174171150..174171280 AGTGGTGTAGCGAGCGAACT Chr2:174171273..174171292 60.08 55
downstream ENSMUSE00000466954 Chr2:174171491..174171558 No primer for this exon
downstream ENSMUSE00000638797 Chr2:174171491..174171558 No primer for this exon
downstream ENSMUSE00000548447 Chr2:174171743..174172003 CGGTGTTGATCATGCCCTAT Chr2:174171996..174172015 60.74 50
downstream ENSMUSE00000592011 Chr2:174171743..174172245 AGGGAACTTTTGTGGCCTTT Chr2:174172126..174172145 59.98 45
downstream ENSMUSE00000679003 Chr2:174171743..174172213 AGGGAACTTTTGTGGCCTTT Chr2:174172126..174172145 59.98 45
downstream ENSMUSE00000679015 Chr2:174171743..174172213 AGGGAACTTTTGTGGCCTTT Chr2:174172126..174172145 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTAGTTGCCCTGACCAAA Chr2:174113979..174113999 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTAGTTGCCCTGACCAAA Chr2:174113979..174113999 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027523