Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34756
Trapped Gene
AC108848.12 (ENSMUSG00000063656)
Vector Insertion
Chr 5: 73357046 - 73365945
Public Clones IST14842G9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000468782 (Chr5:73365768..73365944 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTGAGGAGGTGGTTTGTG Chr5:73365890..73365909 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000468782 (Chr5:73365768..73365944 -)
Downstram Exon
ENSMUSE00000475487 (Chr5:73357047..73357118 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTGAGGAGGTGGTTTGTG Chr5:73365890..73365909 60 55 AAAGCCAAACAGTTGCTTCC Chr5:73357059..73357078 59.36 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000468782 Chr5:73365768..73365944 AGGTGAGGAGGTGGTTTGTG Chr5:73365890..73365909 60 55
upstream ENSMUSE00000475487 Chr5:73357047..73357118 GGCAAACTTTTCAGCCTTTG Chr5:73357048..73357067 59.86 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGACTGAACCCACGACAT Chr5:73362896..73362916 59.97 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGACTGAACCCACGACAT Chr5:73362896..73362916 59.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063656