Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34773
Trapped Gene
Nlrp4e (ENSMUSG00000045693)
Vector Insertion
Chr 7: 24106959 - 24121200
Public Clones IST14261A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000598924 (Chr7:24105386..24106958 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGACGTATCACTTCCCTGT Chr7:24106200..24106219 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000598924 (Chr7:24105386..24106958 +)
Downstram Exon
ENSMUSE00000598923 (Chr7:24121201..24121359 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGACGTATCACTTCCCTGT Chr7:24106200..24106219 59.99 55 AGAGCACACATGATGCCAAC Chr7:24121240..24121259 59.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000598925 Chr7:24086294..24086577 GTTGGGGCTGAAACACATTT Chr7:24086405..24086424 59.84 45
upstream ENSMUSE00000598924 Chr7:24105386..24106958 CCGACGTATCACTTCCCTGT Chr7:24106200..24106219 59.99 55

*** Putative Vector Insertion (Chr 7: 24106959 - 24121200) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000598923 Chr7:24121201..24121359 AGAGCACACATGATGCCAAC Chr7:24121240..24121259 59.71 50
downstream ENSMUSE00000598922 Chr7:24121752..24121916 AAGAGCTGCAAACGTTGGTT Chr7:24121829..24121848 59.92 45
downstream ENSMUSE00000598921 Chr7:24125447..24125614 TCAGGACGGAGACAAAGACC Chr7:24125505..24125524 60.24 55
downstream ENSMUSE00000598920 Chr7:24128052..24128222 CAAGGTTTTGTTCCGCCTAA Chr7:24128127..24128146 60.1 45
downstream ENSMUSE00000598919 Chr7:24138190..24138360 AGGAGCTTCACACCAGCATC Chr7:24138318..24138337 60.42 55
downstream ENSMUSE00000636657 Chr7:24140019..24140036 No primer for this exon
downstream ENSMUSE00000488484 Chr7:24140126..24140296 TCACAGCAGGCACCAGTTAG Chr7:24140164..24140183 60.05 55
downstream ENSMUSE00000290019 Chr7:24146860..24147289 CCAGAACATCCACCCTTGTT Chr7:24146987..24147006 59.82 50
downstream ENSMUSE00000598918 Chr7:24146860..24146941 CATCAGGAACTCCTGGGTTT Chr7:24146908..24146927 58.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATAATCGCCTTGCAGCACA Chr7:24110008..24110028 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCCTTTCTGTCCCCTTTTC Chr7:24109976..24109997 59.56 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045693