Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34781
Trapped Gene
Mto1 (ENSMUSG00000032342)
Vector Insertion
Chr 9: 78312810 - 78318437
Public Clones IST12513A12 (tigm) IST12513A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000269774 (Chr9:78312691..78312809 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGCTCGCCAGAAGACTGA Chr9:78312781..78312800 60.43 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000269774 (Chr9:78312691..78312809 +)
Downstram Exon
ENSMUSE00000269759 (Chr9:78318438..78318598 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGCTCGCCAGAAGACTGA Chr9:78312781..78312800 60.43 55 CTGTGGGCGACTCAAGTGTA Chr9:78318598..78318617 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000218877 Chr9:78296027..78296317 CTGGCTTCTACTCCGGTGAC Chr9:78296051..78296070 59.87 60
upstream ENSMUSE00000218893 Chr9:78297226..78297425 GCACAGATTGACCGGAAACT Chr9:78297387..78297406 60.12 50
upstream ENSMUSE00000353823 Chr9:78297525..78297642 GGGTCAGAGGTGTTGTCCTG Chr9:78297622..78297641 60.56 60
upstream ENSMUSE00000269893 Chr9:78300571..78300860 TCCATAGGGTTGGCTCAGAC Chr9:78300687..78300706 60.07 55
upstream ENSMUSE00000218895 Chr9:78305017..78305129 GAGTGGATGCGATTGTCCTT Chr9:78305060..78305079 60.08 50
upstream ENSMUSE00000269839 Chr9:78305223..78305413 CCCGCAAGGGTTATCTGTTA Chr9:78305319..78305338 59.95 50
upstream ENSMUSE00000269816 Chr9:78305724..78305854 CCCTCGAGACACACTTGGTT Chr9:78305772..78305791 60.15 55
upstream ENSMUSE00000218875 Chr9:78308640..78308844 GGGGTGATAGCTGGAATCAA Chr9:78308640..78308659 59.89 50
upstream ENSMUSE00000218882 Chr9:78309327..78309498 TGTGTGTCCTCACAGCGATT Chr9:78309344..78309363 60.32 50
upstream ENSMUSE00000269774 Chr9:78312691..78312809 AGAGCTCGCCAGAAGACTGA Chr9:78312781..78312800 60.43 55

*** Putative Vector Insertion (Chr 9: 78312810 - 78318437) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000269759 Chr9:78318438..78318598 CTGTGGGCGACTCAAGTGTA Chr9:78318598..78318617 59.9 55
downstream ENSMUSE00000218867 Chr9:78321597..78321957 GAGACTCCCACAGGGATTGA Chr9:78321895..78321914 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCGCCAGAAGACTGAAAA Chr9:78312785..78312805 60.66 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCGCCAGAAGACTGAAAA Chr9:78312785..78312805 60.66 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032342