Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34803
Trapped Gene
OTTMUSG00000016219 (ENSMUSG00000078877)
Vector Insertion
Chr 2: 176586941 - 176592066
Public Clones IST14962B8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678674 (Chr2:176586886..176586940 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGATGCTGTGAATTTAGC Chr2:176586893..176586913 59.87 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678674 (Chr2:176586886..176586940 +)
Downstram Exon
ENSMUSE00000678673 (Chr2:176592067..176592193 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGATGCTGTGAATTTAGC Chr2:176586893..176586913 59.87 47.62 CACCTGCACGTCATCATAGG Chr2:176592099..176592118 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678675 Chr2:176583317..176583423 TGCGTGACTCTACTGGGTGT Chr2:176583365..176583384 59.34 55
upstream ENSMUSE00000678674 Chr2:176586886..176586940 GCTGGATGCTGTGAATTTAGC Chr2:176586893..176586913 59.87 47.62
upstream ENSMUSE00000715007 Chr2:176586886..176586940 GCTGGATGCTGTGAATTTAGC Chr2:176586893..176586913 59.87 47.62

*** Putative Vector Insertion (Chr 2: 176586941 - 176592066) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678673 Chr2:176592067..176592193 CACCTGCACGTCATCATAGG Chr2:176592099..176592118 60.14 55
downstream ENSMUSE00000678672 Chr2:176592400..176592460 No primer for this exon
downstream ENSMUSE00000720471 Chr2:176592400..176593523 CAGCAATGTTCGGAAACAAA Chr2:176593185..176593204 59.71 40
downstream ENSMUSE00000678671 Chr2:176593615..176595928 TGGAGATGACTGCTTTGTGC Chr2:176594118..176594137 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGTGTCATGTCCCACAAA Chr2:176586948..176586968 60.58 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAACGTGACTGGGAAAAC Chr2:176589987..176590007 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078877