Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3481
Trapped Gene
Glrx3 (ENSMUSG00000031068)
Vector Insertion
Chr 7: 144629455 - 144636661
Public Clones AD0123 (sanger) 3SD002E01 (ggtc) E029C06 (ggtc) IST10818E10 (tigm)
Private Clones OST452485 (lexicon) OST138164 (lexicon) OST114711 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000587230 (Chr7:144629346..144629454 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCTACTGCGCCTCAAAAC Chr7:144629432..144629451 60.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000587230 (Chr7:144629346..144629454 +)
Downstram Exon
ENSMUSE00000465947 (Chr7:144636662..144636770 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCTACTGCGCCTCAAAAC Chr7:144629432..144629451 60.16 55 GCCATGACATCGTTCATCTG Chr7:144636733..144636752 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000587230 Chr7:144629346..144629454 GAGCTACTGCGCCTCAAAAC Chr7:144629432..144629451 60.16 55

*** Putative Vector Insertion (Chr 7: 144629455 - 144636661) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000465947 Chr7:144636662..144636770 GCCATGACATCGTTCATCTG Chr7:144636733..144636752 60.08 50
downstream ENSMUSE00000205914 Chr7:144644380..144644454 GGTGGGGACAGAGCTAATTTC Chr7:144644441..144644461 59.95 52.38
downstream ENSMUSE00000324353 Chr7:144645096..144645297 GTCAGCTTTTTCAGGCGAAG Chr7:144645244..144645263 60.13 50
downstream ENSMUSE00000587229 Chr7:144650806..144650978 GTACGTTTTGAGCCCCTGTC Chr7:144650912..144650931 59.6 55
downstream ENSMUSE00000587228 Chr7:144651164..144651225 CCAGCTCTTCTGATGCTTCC Chr7:144651191..144651210 60.1 55
downstream ENSMUSE00000587227 Chr7:144653029..144653086 CGGAAGCTTTATTGGTCAGC Chr7:144653060..144653079 59.85 50
downstream ENSMUSE00000421474 Chr7:144654644..144654696 TGCTGAATCCACATTTTGCT Chr7:144654668..144654687 59.28 40
downstream ENSMUSE00000205918 Chr7:144655781..144655820 No primer for this exon
downstream ENSMUSE00000205909 Chr7:144656098..144656190 GGTAGGTTGGCCAATTTGAG Chr7:144656143..144656162 59.43 50
downstream ENSMUSE00000587226 Chr7:144659616..144659865 AGTCCTTGGACACCATGCTT Chr7:144659696..144659715 59.58 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAGCTACTGCGCCTCAAA Chr7:144629431..144629451 60.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGAGCTACTGCGCCTCAA Chr7:144632430..144632450 60.82 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031068