Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34814
Trapped Gene
Tgfbr1 (ENSMUSG00000007613)
Vector Insertion
Chr 4: 47396867 - 47399279
Public Clones IST11177C12 (tigm) IST10099E4 (tigm) IST11575B8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000178302 (Chr4:47396621..47396866 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000178302 (Chr4:47396621..47396866 +)
Downstram Exon
ENSMUSE00000632705 (Chr4:47399280..47399361 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000178301 Chr4:47366177..47366268 No primer for this exon
upstream ENSMUSE00000674233 Chr4:47366179..47366268 No primer for this exon
upstream ENSMUSE00000178302 Chr4:47396621..47396866 No primer for this exon

*** Putative Vector Insertion (Chr 4: 47396867 - 47399279) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000632705 Chr4:47399280..47399361 No primer for this exon
downstream ENSMUSE00000230734 Chr4:47406119..47406361 No primer for this exon
downstream ENSMUSE00000674231 Chr4:47406131..47406361 No primer for this exon
downstream ENSMUSE00000527316 Chr4:47409227..47409457 No primer for this exon
downstream ENSMUSE00000178298 Chr4:47415675..47415842 No primer for this exon
downstream ENSMUSE00000178299 Chr4:47416242..47416398 No primer for this exon
downstream ENSMUSE00000527315 Chr4:47418401..47418525 No primer for this exon
downstream ENSMUSE00000178300 Chr4:47419794..47419924 No primer for this exon
downstream ENSMUSE00000475457 Chr4:47423524..47427795 No primer for this exon
downstream ENSMUSE00000527314 Chr4:47423524..47425005 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTTGCATTAGCACCCTTC Chr4:47396873..47396893 58.77 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTTGCATTAGCACCCTTC Chr4:47396873..47396893 58.77 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007613