Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34817
Trapped Gene
Abca17 (ENSMUSG00000035435)
Vector Insertion
Chr 17: 24484143 - 24487975
Public Clones IST14026C9 (tigm) IST13059B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702666 (Chr17:24487913..24487974 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCAGACCTGCCTAGCCTTA Chr17:24487915..24487934 58.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702666 (Chr17:24487913..24487974 -)
Downstram Exon
ENSMUSE00000720183 (Chr17:24484144..24484230 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCAGACCTGCCTAGCCTTA Chr17:24487915..24487934 58.96 55 CCAGCTGAAGAAGAAGCTCAA Chr17:24484186..24484206 59.88 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702666 Chr17:24487913..24487974 ACCAGACCTGCCTAGCCTTA Chr17:24487915..24487934 58.96 55
upstream ENSMUSE00000360559 Chr17:24484144..24484197 No primer for this exon
upstream ENSMUSE00000702665 Chr17:24484144..24484230 GGGAAAAGAAAAATGGAGGTG Chr17:24484189..24484209 59.8 42.86
upstream ENSMUSE00000720183 Chr17:24484144..24484230 GGGAAAAGAAAAATGGAGGTG Chr17:24484189..24484209 59.8 42.86

*** Putative Vector Insertion (Chr 17: 24484143 - 24487975) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000308444 Chr17:24483086..24483347 GCCGGGTAGTTGGTAGATGA Chr17:24483207..24483226 59.96 55
downstream ENSMUSE00000702664 Chr17:24472491..24472607 GGCACTGAAGGAAAGCCTAGA Chr17:24472564..24472584 60.88 52.38
downstream ENSMUSE00000419221 Chr17:24472480..24472607 GCAAAGGTTCATTGCTGCTA Chr17:24472466..24472485 59.07 45
downstream ENSMUSE00000332929 Chr17:24471071..24471236 CTCGGCGGTGATACAAAGTT Chr17:24471159..24471178 60.13 50
downstream ENSMUSE00000552995 Chr17:24465474..24465733 CACCAAGACGTGGAGATCCT Chr17:24465599..24465618 60.11 55
downstream ENSMUSE00000374227 Chr17:24464584..24464700 AAAACGTGATGAACCAAGCA Chr17:24464615..24464634 59.17 40
downstream ENSMUSE00000383367 Chr17:24463301..24463418 AAAGAAAATTGTGGCGATGG Chr17:24463310..24463329 59.94 40
downstream ENSMUSE00000333685 Chr17:24457919..24458092 CATGGCAACATTGGAGAAGA Chr17:24457937..24457956 59.65 45
downstream ENSMUSE00000377734 Chr17:24455101..24455273 AGCTGAAGTCTCCCCAGACA Chr17:24455201..24455220 59.99 55
downstream ENSMUSE00000308613 Chr17:24454059..24454184 CCCTTTTGACGGTTTCTCAG Chr17:24454100..24454119 59.71 50
downstream ENSMUSE00000372157 Chr17:24450136..24450265 TGCCCCTTGTACAGGTTCAT Chr17:24450176..24450195 60.38 50
downstream ENSMUSE00000419140 Chr17:24444391..24444545 GCCCAGGCTCTTCCTAATTT Chr17:24444438..24444457 59.69 50
downstream ENSMUSE00000502745 Chr17:24437236..24437391 GGTTTGCTCGTGACAGTCCT Chr17:24437331..24437350 60.31 55
downstream ENSMUSE00000552990 Chr17:24436925..24437135 CAGCTTCGTCCATGAAGTGA Chr17:24436987..24437006 59.98 50
downstream ENSMUSE00000612074 Chr17:24435898..24436048 TGCATTCGGTATGTGGTGAT Chr17:24435938..24435957 59.81 45
downstream ENSMUSE00000612073 Chr17:24433209..24433307 TGGTTACAGAGGTGGCAAAA Chr17:24433209..24433228 59.17 45
downstream ENSMUSE00000612072 Chr17:24432030..24432192 GCTGGGATCAGCCAACTTAC Chr17:24432146..24432165 59.7 55
downstream ENSMUSE00000612071 Chr17:24428498..24428804 AGCTCCAGTGGCACGTTATC Chr17:24428607..24428626 60.28 55
downstream ENSMUSE00000612070 Chr17:24426281..24426554 GAAGCATTGGCTCCAGAAAG Chr17:24426325..24426344 59.96 50
downstream ENSMUSE00000612069 Chr17:24425941..24426145 CAGAGTGGGAACGAGGAAAG Chr17:24425928..24425947 59.84 55
downstream ENSMUSE00000612068 Chr17:24424675..24424894 CATCACCACGAGCTTCACAC Chr17:24424708..24424727 60.32 55
downstream ENSMUSE00000612067 Chr17:24422561..24422719 No primer for this exon
downstream ENSMUSE00000612066 Chr17:24418165..24418352 TCCCAGGCGTAGATGTTCTC Chr17:24418291..24418310 60.22 55
downstream ENSMUSE00000612065 Chr17:24417380..24417502 CAACAAGCGGGTTTTTCTTT Chr17:24417375..24417394 59.24 40
downstream ENSMUSE00000612064 Chr17:24415993..24416187 CCAGCTCCATTGAGACCAAG Chr17:24416068..24416087 60.79 55
downstream ENSMUSE00000612063 Chr17:24404495..24404682 AAGGATCAGGTCGACACAGG Chr17:24404523..24404542 60.11 55
downstream ENSMUSE00000612062 Chr17:24402809..24402979 TAGCATGCGCTTGTTACCAC Chr17:24402936..24402955 59.9 50
downstream ENSMUSE00000612061 Chr17:24402368..24402558 AGGGAGTAGCTGATGCCAAA Chr17:24402423..24402442 59.84 50
downstream ENSMUSE00000612060 Chr17:24402149..24402222 TTGGTGCTCGTCTTCCAAAT Chr17:24402175..24402194 60.64 45
downstream ENSMUSE00000612059 Chr17:24401224..24401487 TAGGGATAGCTGGCTGATGG Chr17:24401394..24401413 60.19 55
downstream ENSMUSE00000719730 Chr17:24401204..24401487 TAGGGATAGCTGGCTGATGG Chr17:24401394..24401413 60.19 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCAGACCTTAATCGCCTTG Chr17:24487913..24487933 59.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACCTCGTGACTGGGAAAAC Chr17:24484909..24484930 60.54 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035435