Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34823
Trapped Gene
Gabarapl2 (ENSMUSG00000031950)
Vector Insertion
Chr 8: 114464753 - 114465059
Public Clones IST14600B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000359315 (Chr8:114464622..114464752 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTGTTGTTGTGGTCGCTTC Chr8:114464652..114464671 59.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000359315 (Chr8:114464622..114464752 +)
Downstram Exon
ENSMUSE00000214915 (Chr8:114465060..114465115 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTGTTGTTGTGGTCGCTTC Chr8:114464652..114464671 59.19 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359315 Chr8:114464622..114464752 GTTGTTGTTGTGGTCGCTTC Chr8:114464652..114464671 59.19 50

*** Putative Vector Insertion (Chr 8: 114464753 - 114465059) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214915 Chr8:114465060..114465115 No primer for this exon
downstream ENSMUSE00000214916 Chr8:114466402..114466574 AACAATCTGAGAGCCCGAGA Chr8:114466440..114466459 59.95 50
downstream ENSMUSE00000397727 Chr8:114476215..114476814 GTGTTCTCTCCGCTGTAGGC Chr8:114476295..114476314 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACTCTAATCGCCTTGCAG Chr8:114464798..114464818 60.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTCCGTGACTGGGAAAAC Chr8:114464799..114464819 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031950