Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34827
Trapped Gene
Centa2 (ENSMUSG00000020709)
Vector Insertion
Chr 11: 79979322 - 79984179
Public Clones IST13758F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108358 (Chr11:79979175..79979321 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108358 (Chr11:79979175..79979321 +)
Downstram Exon
ENSMUSE00000108360 (Chr11:79984180..79984263 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349664 Chr11:79967613..79967811 No primer for this exon
upstream ENSMUSE00000283569 Chr11:79968492..79968622 No primer for this exon
upstream ENSMUSE00000108355 Chr11:79970447..79970538 No primer for this exon
upstream ENSMUSE00000108361 Chr11:79973665..79973744 No primer for this exon
upstream ENSMUSE00000108363 Chr11:79975650..79975762 No primer for this exon
upstream ENSMUSE00000108358 Chr11:79979175..79979321 No primer for this exon

*** Putative Vector Insertion (Chr 11: 79979322 - 79984179) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108360 Chr11:79984180..79984263 No primer for this exon
downstream ENSMUSE00000108356 Chr11:79987590..79987652 No primer for this exon
downstream ENSMUSE00000108353 Chr11:79989558..79989635 No primer for this exon
downstream ENSMUSE00000373060 Chr11:79990548..79990776 No primer for this exon
downstream ENSMUSE00000332693 Chr11:79991898..79992417 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCCCAGATTCCTGGGTAA Chr11:79979356..79979376 59.74 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCATGACAGTGGGAAGGTGA Chr11:79979306..79979327 60.38 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020709