Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34835
Trapped Gene
Gdap2 (ENSMUSG00000027865)
Vector Insertion
Chr 3: 99991957 - 99994808
Public Clones IST13334A9 (tigm) IST14477D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000173744 (Chr3:99991797..99991956 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGGCTCTCATGCTTTTGC Chr3:99991847..99991866 60.36 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000173744 (Chr3:99991797..99991956 +)
Downstram Exon
ENSMUSE00000173738 (Chr3:99994809..99994885 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGGCTCTCATGCTTTTGC Chr3:99991847..99991866 60.36 45 GATCTTGCTTGGCATAACCA Chr3:99994841..99994860 58.72 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000705635 Chr3:99966388..99966588 CTGAATTCTGCCACGGATCT Chr3:99966525..99966544 60.22 50
upstream ENSMUSE00000320856 Chr3:99966441..99966588 CTGAATTCTGCCACGGATCT Chr3:99966525..99966544 60.22 50
upstream ENSMUSE00000320849 Chr3:99973859..99974098 CCTTCCCAGTTTGTGGATGT Chr3:99973941..99973960 59.82 50
upstream ENSMUSE00000712294 Chr3:99973859..99974098 CCTTCCCAGTTTGTGGATGT Chr3:99973941..99973960 59.82 50
upstream ENSMUSE00000173745 Chr3:99974821..99974960 CTGAACTGCACAGCCATTGT Chr3:99974840..99974859 59.9 50
upstream ENSMUSE00000173739 Chr3:99981766..99981919 CCGAACTGGTGAAGCAAAAT Chr3:99981770..99981789 60.11 45
upstream ENSMUSE00000173741 Chr3:99982157..99982245 GATGCAACACACATCGCTCT Chr3:99982224..99982243 59.87 50
upstream ENSMUSE00000173740 Chr3:99986600..99986676 CTGTGAGGCGGTTCCTAGAG Chr3:99986603..99986622 60.01 60
upstream ENSMUSE00000173746 Chr3:99990493..99990652 AAAGGAGGAGATCCGGTCAT Chr3:99990537..99990556 59.9 50
upstream ENSMUSE00000173744 Chr3:99991797..99991956 ATTGGCTCTCATGCTTTTGC Chr3:99991847..99991866 60.36 45

*** Putative Vector Insertion (Chr 3: 99991957 - 99994808) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000173738 Chr3:99994809..99994885 GATCTTGCTTGGCATAACCA Chr3:99994841..99994860 58.72 45
downstream ENSMUSE00000173743 Chr3:99995550..99995626 TGTGCGGCCACAGTTATCTA Chr3:99995575..99995594 60.28 50
downstream ENSMUSE00000173747 Chr3:99998413..99998552 CTTCAGGAAGTCGGAGTCCA Chr3:99998529..99998548 60.38 55
downstream ENSMUSE00000173736 Chr3:100000466..100000520 TGAACGGAATGTTGGATGAA Chr3:100000520..100000539 59.9 40
downstream ENSMUSE00000173742 Chr3:100005897..100006040 TCGCGTCATATTCAAGGACA Chr3:100006041..100006060 60.22 45
downstream ENSMUSE00000671789 Chr3:100005897..100006393 CGTGACACACCCATATGCTC Chr3:100006122..100006141 59.99 55
downstream ENSMUSE00000320776 Chr3:100009695..100010575 GATAGGTGGCGAGTTGTGGT Chr3:100009807..100009826 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCAGAAGCAGCATCAAAG Chr3:99991935..99991955 59.89 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCAGAAGCAGCATCAAAG Chr3:99991935..99991955 59.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027865