Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3484
Trapped Gene
Gmnn (ENSMUSG00000006715)
Vector Insertion
Chr 13: 24853681 - 24853731
Public Clones XT0615 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683721 (Chr13:24853682..24853806 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683721 (Chr13:24853682..24853806 -)
Downstram Exon
ENSMUSE00000252206 (Chr13:24853456..24853730 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683721 Chr13:24853682..24853806 No primer for this exon

*** Putative Vector Insertion (Chr 13: 24853681 - 24853731) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000252206 Chr13:24853456..24853730 No primer for this exon
downstream ENSMUSE00000331951 Chr13:24852029..24852086 No primer for this exon
downstream ENSMUSE00000715599 Chr13:24852029..24852086 No primer for this exon
downstream ENSMUSE00000117097 Chr13:24849465..24849542 No primer for this exon
downstream ENSMUSE00000117092 Chr13:24848469..24848604 No primer for this exon
downstream ENSMUSE00000516080 Chr13:24845527..24845609 No primer for this exon
downstream ENSMUSE00000117096 Chr13:24845217..24845327 No primer for this exon
downstream ENSMUSE00000372842 Chr13:24843715..24844099 No primer for this exon
downstream ENSMUSE00000683720 Chr13:24843714..24844099 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTCTTAATCGCCTTGCAG Chr13:24853666..24853686 58.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000006715