Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34865
Trapped Gene
Syt1 (ENSMUSG00000035864)
Vector Insertion
Chr 10: 107941452 - 108021048
Public Clones IST11231H9 (tigm) IST13114H4 (tigm) IST13918A12 (tigm) IST13114H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 73% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000573946 (Chr10:108020930..108021047 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATGTGGGTGGCTTATCTG Chr10:108020930..108020949 60.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000573946 (Chr10:108020930..108021047 -)
Downstram Exon
ENSMUSE00000573945 (Chr10:107941453..107941586 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATGTGGGTGGCTTATCTG Chr10:108020930..108020949 60.34 55 CTCGAACGGAACTTCAAAGC Chr10:107941440..107941459 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000438567 Chr10:108447632..108448022 ACCAAGACTCGCACCATCTC Chr10:108447652..108447671 60.27 55
upstream ENSMUSE00000665604 Chr10:108447632..108448031 ACCAAGACTCGCACCATCTC Chr10:108447652..108447671 60.27 55
upstream ENSMUSE00000665603 Chr10:108430894..108430973 No primer for this exon
upstream ENSMUSE00000438554 Chr10:108339271..108339371 ACCAACATCCGCAGTCTGAT Chr10:108339324..108339343 60.54 50
upstream ENSMUSE00000438525 Chr10:108268162..108268227 CCAGACTACCCCAGCAGAAC Chr10:108268163..108268182 59.72 60
upstream ENSMUSE00000438542 Chr10:108127940..108128119 CCTTTTCCAAGCTGAAGCAG Chr10:108127971..108127990 60.12 50
upstream ENSMUSE00000719619 Chr10:108127940..108128119 CCTTTTCCAAGCTGAAGCAG Chr10:108127971..108127990 60.12 50
upstream ENSMUSE00000438521 Chr10:108079270..108079454 TAGCCATAGTTGCGGTCCTT Chr10:108079411..108079430 59.73 50
upstream ENSMUSE00000438509 Chr10:108073607..108073729 TGACGATGCTGAAACTGGAC Chr10:108073699..108073718 59.84 50
upstream ENSMUSE00000438501 Chr10:108068852..108069019 GACAAAAGTCCACCGGAAAA Chr10:108068890..108068909 59.95 45
upstream ENSMUSE00000573947 Chr10:108064309..108064476 CTTCTCCAAGCACGACATCA Chr10:108064398..108064417 59.98 50
upstream ENSMUSE00000573946 Chr10:108020930..108021047 GGATGTGGGTGGCTTATCTG Chr10:108020930..108020949 60.34 55
upstream ENSMUSE00000573945 Chr10:107941453..107941586 GCTTTGAAGTTCCGTTCGAG Chr10:107941462..107941481 59.99 50

*** Putative Vector Insertion (Chr 10: 107941452 - 108021048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000500014 Chr10:107934708..107937802 CTCAGCGAGACAAATGTGGA Chr10:107935850..107935869 59.98 50
downstream ENSMUSE00000665602 Chr10:107934706..107937802 CTCAGCGAGACAAATGTGGA Chr10:107935850..107935869 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTAATCGCCTTGCAGCACA Chr10:107978979..107978999 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAATCTAAATAAACCTGCGACA Chr10:107979046..107979069 60.49 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035864