Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34873
Trapped Gene
Tmem28 (ENSMUSG00000071719)
Vector Insertion
Chr X: 97017266 - 97040727
Public Clones IST12752D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000623035 (ChrX:97016360..97017265 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCTCCTTTTGCGACACCT ChrX:97016989..97017008 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000623035 (ChrX:97016360..97017265 +)
Downstram Exon
ENSMUSE00000623034 (ChrX:97040728..97040899 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCTCCTTTTGCGACACCT ChrX:97016989..97017008 59.99 50 CTGCACCTCCAGGCAGTATT ChrX:97040829..97040848 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000623035 ChrX:97016360..97017265 TCTCTCCTTTTGCGACACCT ChrX:97016989..97017008 59.99 50

*** Putative Vector Insertion (Chr X: 97017266 - 97040727) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000623034 ChrX:97040728..97040899 CTGCACCTCCAGGCAGTATT ChrX:97040829..97040848 60.28 55
downstream ENSMUSE00000623032 ChrX:97041299..97044129 GCCAGCCTCTGAACTTTGTC ChrX:97042944..97042963 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTCTCTTAATCGCCTTGC ChrX:97026309..97026329 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCGTGACTGGGAAAACC ChrX:97026313..97026333 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071719