Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3488
Trapped Gene
Actb (ENSMUSG00000029580)
Vector Insertion
Chr 5: 143667372 - 143668330
Public Clones AC0695 (sanger) RST670 (baygenomics) GST111 (baygenomics) RST671 (baygenomics)
RST664 (baygenomics) M021B06 (ggtc) P128H10 (ggtc) NAISTrap_32v1001 (NAISTrap)
Private Clones OST288644 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000336366 (Chr5:143668331..143668404 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCTTTGCAGCTCCTTCGTT Chr5:143668353..143668372 60.13 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000336366 (Chr5:143668331..143668404 -)
Downstram Exon
ENSMUSE00000511388 (Chr5:143667243..143667371 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCTTTGCAGCTCCTTCGTT Chr5:143668353..143668372 60.13 45 GCAGCGATATCGTCATCCAT Chr5:143667324..143667343 61.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336366 Chr5:143668331..143668404 TTCTTTGCAGCTCCTTCGTT Chr5:143668353..143668372 60.13 45

*** Putative Vector Insertion (Chr 5: 143667372 - 143668330) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000648207 Chr5:143667302..143667361 No primer for this exon
downstream ENSMUSE00000511388 Chr5:143667243..143667371 GCAGCGATATCGTCATCCAT Chr5:143667324..143667343 61.01 50
downstream ENSMUSE00000648206 Chr5:143667243..143667299 CACGATGGAGGGGAATACAG Chr5:143667239..143667258 60.33 55
downstream ENSMUSE00000510722 Chr5:143666916..143667155 CTTCTCCATGTCGTCCCAGT Chr5:143667005..143667024 60.11 55
downstream ENSMUSE00000517504 Chr5:143666023..143666461 GGGGTGTTGAAGGTCTCAAA Chr5:143666414..143666433 59.94 50
downstream ENSMUSE00000534432 Chr5:143665746..143665927 CGGATGTCAACGTCACACTT Chr5:143665839..143665858 59.6 50
downstream ENSMUSE00000706455 Chr5:143665420..143665620 GTACTTGCGCTCAGGAGGAG Chr5:143665572..143665591 60.16 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCTTCTTTGCAGCTCCTT Chr5:143668355..143668375 59.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCTTCTTTGCAGCTCCTT Chr5:143668355..143668375 59.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029580