Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34884
Trapped Gene
Clec2d (ENSMUSG00000030157)
Vector Insertion
Chr 6: 129130766 - 129133109
Public Clones IST10720D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000379117 (Chr6:129130640..129130765 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGTGTCACAAAGGCTTCC Chr6:129130700..129130719 59.73 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000379117 (Chr6:129130640..129130765 +)
Downstram Exon
ENSMUSE00000320891 (Chr6:129133110..129133235 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGTGTCACAAAGGCTTCC Chr6:129130700..129130719 59.73 50 AGATGGTTCCGTGCCTTTTT Chr6:129133148..129133167 60.86 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000379117 Chr6:129130640..129130765 TGTGTGTCACAAAGGCTTCC Chr6:129130700..129130719 59.73 50

*** Putative Vector Insertion (Chr 6: 129130766 - 129133109) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000320891 Chr6:129133110..129133235 AGATGGTTCCGTGCCTTTTT Chr6:129133148..129133167 60.86 45
downstream ENSMUSE00000195934 Chr6:129134153..129134331 CTGGGCGAATGTCCAGTTAC Chr6:129134277..129134296 60.52 55
downstream ENSMUSE00000195932 Chr6:129134796..129134902 AGGGTGCTCTGACGACTCTC Chr6:129134870..129134889 59.58 60
downstream ENSMUSE00000513895 Chr6:129135885..129136552 GGTACTGCTGATCCCGTTGT Chr6:129135948..129135967 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGGGCAGAGAGGAGTTTC Chr6:129130797..129130817 60.34 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGGGCAGAGAGGAGTTTC Chr6:129130797..129130817 60.34 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030157