Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34885
Trapped Gene
D5Ertd579e (ENSMUSG00000029190)
Vector Insertion
Chr 5: 37062640 - 37087194
Public Clones (ggtc) IST14462F3 (tigm) IST14605B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000470842 (Chr5:37087094..37087193 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000470842 (Chr5:37087094..37087193 -)
Downstram Exon
ENSMUSE00000363577 (Chr5:37062641..37064481 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACCCAAGACTGAGTGGGATG Chr5:37063101..37063120 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000470842 Chr5:37087094..37087193 No primer for this exon
upstream ENSMUSE00000546420 Chr5:37063987..37064157 TTCTGACATGTCGCTGCTTC Chr5:37064118..37064137 60.14 50
upstream ENSMUSE00000363577 Chr5:37062641..37064481 TCTCCGGATTCCAACAGAAC Chr5:37064269..37064288 60.05 50

*** Putative Vector Insertion (Chr 5: 37062640 - 37087194) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000653882 Chr5:37061481..37061506 No primer for this exon
downstream ENSMUSE00000653881 Chr5:37061313..37061325 No primer for this exon
downstream ENSMUSE00000653880 Chr5:37060427..37060436 No primer for this exon
downstream ENSMUSE00000653879 Chr5:37059870..37059888 No primer for this exon
downstream ENSMUSE00000546416 Chr5:36966818..36966852 No primer for this exon
downstream ENSMUSE00000698414 Chr5:36963852..36963898 GGCCCGCAATTATAATCCAC Chr5:36963852..36963871 61.38 50
downstream ENSMUSE00000546428 Chr5:36963042..36963073 AATGCTGAAAGCACACATGG Chr5:36963027..36963046 59.72 45
downstream ENSMUSE00000546427 Chr5:36962313..36962379 No primer for this exon
downstream ENSMUSE00000186745 Chr5:36961392..36961473 GGGGACAATTCTTCCTCTGG Chr5:36961394..36961413 60.82 55
downstream ENSMUSE00000350215 Chr5:36955895..36959183 GCAATCCCTTCTGGTTCAAA Chr5:36956477..36956496 60.05 45
downstream ENSMUSE00000698418 Chr5:36950587..36950695 AGCTTTTTCCCACCAGCTCT Chr5:36950602..36950621 60.38 50
downstream ENSMUSE00000186758 Chr5:36947160..36947257 ACAGACGCTCTTCACGACTG Chr5:36947152..36947171 59.21 55
downstream ENSMUSE00000698416 Chr5:36943153..36945452 TACATCACAGCCACGAGAGC Chr5:36944397..36944416 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCAGGCTCACTCCTTCTTG Chr5:37084149..37084170 59.73 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGGCATCTCCTGGATCTTA Chr5:37084161..37084182 60.55 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029190