Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34886
Trapped Gene
Tbc1d2b (ENSMUSG00000037410)
Vector Insertion
Chr 9: 90144628 - 90165608
Public Clones IST14995H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000416773 (Chr9:90165190..90165607 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCCGCTGCTACCTCTACTA Chr9:90165344..90165363 60.69 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000416773 (Chr9:90165190..90165607 -)
Downstram Exon
ENSMUSE00000416747 (Chr9:90144629..90144782 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCCGCTGCTACCTCTACTA Chr9:90165344..90165363 60.69 60 CATCATGTCAAGGCTGTTGC Chr9:90144677..90144696 60.27 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416773 Chr9:90165190..90165607 CGCCGCTGCTACCTCTACTA Chr9:90165344..90165363 60.69 60
upstream ENSMUSE00000416747 Chr9:90144629..90144782 TGTGGCCAGAGATACCACAG Chr9:90144629..90144648 59.7 55

*** Putative Vector Insertion (Chr 9: 90144628 - 90165608) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000416737 Chr9:90135848..90136016 AAGTTGATGGGATTCGGATG Chr9:90135859..90135878 59.75 45
downstream ENSMUSE00000416732 Chr9:90123776..90123939 GAGGCGGGTCTAGAAGTTCC Chr9:90123820..90123839 60.21 60
downstream ENSMUSE00000416729 Chr9:90122168..90122412 CTTTGTAAGGGTTCCGTCCA Chr9:90122340..90122359 59.96 50
downstream ENSMUSE00000416724 Chr9:90120859..90121242 TCTGGGGGTTCGTGAAATAC Chr9:90121151..90121170 59.79 50
downstream ENSMUSE00000416721 Chr9:90118277..90118387 GGCTTTTGTACCCTTGCAGA Chr9:90118341..90118360 60.25 50
downstream ENSMUSE00000416719 Chr9:90117145..90117338 GGCTTAACGAATGCTTGCTC Chr9:90117135..90117154 59.99 50
downstream ENSMUSE00000416715 Chr9:90113498..90113992 TGACGGTCAACACACCACTT Chr9:90113710..90113729 60.05 50
downstream ENSMUSE00000416711 Chr9:90110316..90110433 TCCACGATGGTAACGAGACA Chr9:90110343..90110362 60.11 50
downstream ENSMUSE00000357765 Chr9:90104506..90104691 TGACAACGCTGTCCACAAAT Chr9:90104534..90104553 60.16 45
downstream ENSMUSE00000241595 Chr9:90102611..90102732 GCATCGAGGATAGTCCGAGT Chr9:90102592..90102611 59.27 55
downstream ENSMUSE00000390700 Chr9:90096889..90100060 TCAGATCCCCAAAGGAGATG Chr9:90100007..90100026 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr9:90150540..90150560 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGACGGGTCTCTTGGTTGA Chr9:90150567..90150587 60.51 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037410