Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34893
Trapped Gene
Fezf2 (ENSMUSG00000021743)
Vector Insertion
Chr 14: 13176862 - 13178343
Public Clones IST15066C3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000120435 (Chr14:13178101..13178342 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCATGTCATTCCACTTCAA Chr14:13178236..13178255 59.34 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000120435 (Chr14:13178101..13178342 -)
Downstram Exon
ENSMUSE00000120432 (Chr14:13176863..13177752 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCATGTCATTCCACTTCAA Chr14:13178236..13178255 59.34 45 CTCCAGCAGAAAAAGCTTGG Chr14:13177051..13177070 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000120435 Chr14:13178101..13178342 CCCATGTCATTCCACTTCAA Chr14:13178236..13178255 59.34 45
upstream ENSMUSE00000120432 Chr14:13176863..13177752 GCCAGCGGCTCTCTCTACTA Chr14:13177203..13177222 59.88 60

*** Putative Vector Insertion (Chr 14: 13176862 - 13178343) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000294667 Chr14:13176432..13176566 GGCGGGTGAGGTTATAGTGA Chr14:13176514..13176533 59.96 55
downstream ENSMUSE00000120433 Chr14:13176153..13176285 CACAAAACTCGCAGACGAAG Chr14:13176152..13176171 59.63 50
downstream ENSMUSE00000120434 Chr14:13174616..13175272 GTTGGTACAGGGCAGGAAGA Chr14:13174949..13174968 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr14:13178272..13178292 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGTTGCCTCCTTTAAAGTTTGAG Chr14:13178318..13178342 58.29 37.5 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021743