Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34900
Trapped Gene
Spata1 (ENSMUSG00000028188)
Vector Insertion
Chr 3: 146128872 - 146131169
Public Clones IST10414A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000177107 (Chr3:146131070..146131168 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACGCAATTGACCAACTTA Chr3:146131117..146131136 59.74 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000177107 (Chr3:146131070..146131168 -)
Downstram Exon
ENSMUSE00000370519 (Chr3:146128873..146128960 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACGCAATTGACCAACTTA Chr3:146131117..146131136 59.74 45 GAAAGGTGCACCCATTTTCT Chr3:146128864..146128883 59.03 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561579 Chr3:146162619..146162717 No primer for this exon
upstream ENSMUSE00000586216 Chr3:146157920..146158079 CCGTCCTTTCTCCTTCGTCT Chr3:146157962..146157981 60.76 55
upstream ENSMUSE00000358153 Chr3:146156636..146156807 GCTCAATCCAAGTCGACCAT Chr3:146156647..146156666 60.08 50
upstream ENSMUSE00000225508 Chr3:146152775..146152881 CCCTGAAGGATCGTGGAACT Chr3:146152836..146152855 61.42 55
upstream ENSMUSE00000225497 Chr3:146151611..146151728 AAGCTCTGAGGGAGCGTCTT Chr3:146151686..146151705 60.67 55
upstream ENSMUSE00000225484 Chr3:146150476..146150529 No primer for this exon
upstream ENSMUSE00000365374 Chr3:146150164..146150383 TGTCAAAGGATGAACCTGGA Chr3:146150216..146150235 59.06 45
upstream ENSMUSE00000586215 Chr3:146148375..146150529 GCCACAGAACCTGGGTAAAA Chr3:146149892..146149911 59.97 50
upstream ENSMUSE00000225459 Chr3:146144731..146144824 GTTGCTGGGATCATTGGAAG Chr3:146144762..146144781 60.46 50
upstream ENSMUSE00000225447 Chr3:146144092..146144173 AGGATAACGCAGCTCTCAGC Chr3:146144110..146144129 59.75 55
upstream ENSMUSE00000225433 Chr3:146139158..146139266 ATTTCCTTCTCAGCGGGTTT Chr3:146139197..146139216 60.07 45
upstream ENSMUSE00000177113 Chr3:146138220..146138345 No primer for this exon
upstream ENSMUSE00000177109 Chr3:146132589..146132767 AGATGCGACCAAGGAATTTG Chr3:146132610..146132629 60.07 45
upstream ENSMUSE00000177107 Chr3:146131070..146131168 GCACGCAATTGACCAACTTA Chr3:146131117..146131136 59.74 45
upstream ENSMUSE00000370519 Chr3:146128873..146128960 No primer for this exon

*** Putative Vector Insertion (Chr 3: 146128872 - 146131169) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000399643 Chr3:146126149..146126219 TCTAGGTTGGCACACTTCCA Chr3:146126174..146126193 59.29 50
downstream ENSMUSE00000342571 Chr3:146120167..146120468 GTCACCAAAGCGCATAGACA Chr3:146120298..146120317 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACGCAATTGACCAACTAA Chr3:146131115..146131135 59.74 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAATTGACCAACCGTGACTG Chr3:146131110..146131130 60 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028188