Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34902
Trapped Gene
Ctse (ENSMUSG00000004552)
Vector Insertion
Chr 1: 133535135 - 133558452
Public Clones (sanger) (sanger) (sanger) (sanger) IST11549E1 (tigm) IST10871D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000249467 (Chr1:133534891..133535134 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCGTGGTTATCTCCATTTG Chr1:133534956..133534975 60.33 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000249467 (Chr1:133534891..133535134 +)
Downstram Exon
ENSMUSE00000721699 (Chr1:133558453..133558643 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCGTGGTTATCTCCATTTG Chr1:133534956..133534975 60.33 50 CTCACTCTGCTCCGATCTCC Chr1:133558551..133558570 60.1 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000249467 Chr1:133534891..133535134 GGCGTGGTTATCTCCATTTG Chr1:133534956..133534975 60.33 50
upstream ENSMUSE00000691594 Chr1:133535071..133535134 No primer for this exon

*** Putative Vector Insertion (Chr 1: 133535135 - 133558452) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000498258 Chr1:133558453..133558643 CTCACTCTGCTCCGATCTCC Chr1:133558551..133558570 60.1 60
downstream ENSMUSE00000721699 Chr1:133558453..133558643 CTCACTCTGCTCCGATCTCC Chr1:133558551..133558570 60.1 60
downstream ENSMUSE00000706841 Chr1:133558508..133558643 CTCACTCTGCTCCGATCTCC Chr1:133558551..133558570 60.1 60
downstream ENSMUSE00000159003 Chr1:133559190..133559346 GAGTCGGGTCATGTCCAAGT Chr1:133559292..133559311 59.97 55
downstream ENSMUSE00000159000 Chr1:133559888..133560005 TGAACCGGTGTCAAAGATGA Chr1:133559962..133559981 60.09 45
downstream ENSMUSE00000159004 Chr1:133560861..133560979 GTATGTGTCGGACTGCGATG Chr1:133560904..133560923 60.14 55
downstream ENSMUSE00000158999 Chr1:133564614..133564813 AATGAGGGGTATCCCAGACC Chr1:133564729..133564748 60.01 55
downstream ENSMUSE00000159001 Chr1:133567263..133567385 CATAGCCTCCGAAAGTCAGC Chr1:133567312..133567331 59.98 55
downstream ENSMUSE00000159006 Chr1:133568781..133568922 CTTCGGAGCAGAACATCACA Chr1:133568821..133568840 59.98 50
downstream ENSMUSE00000159005 Chr1:133569022..133569120 AAGGTAACGTTTGGCATCGT Chr1:133569071..133569090 59.5 45
downstream ENSMUSE00000471707 Chr1:133571358..133572077 CTAGAGGCGTGGAACCAGAG Chr1:133571898..133571917 60.01 60
downstream ENSMUSE00000691593 Chr1:133571358..133572080 CTAGAGGCGTGGAACCAGAG Chr1:133571898..133571917 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr1:133550186..133550206 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTCCGTGACTGGGAAAAC Chr1:133550181..133550201 58.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004552