Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34912
Trapped Gene
AC109199.10 (ENSMUSG00000026311)
Vector Insertion
Chr 1: 93440875 - 93443504
Public Clones IST14894D3 (tigm) IST11069H12 (tigm) IST11069H12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000598290 (Chr1:93440728..93440874 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAGCAGTTCTGTGACCAT Chr1:93440757..93440776 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000598290 (Chr1:93440728..93440874 +)
Downstram Exon
ENSMUSE00000693965 (Chr1:93443505..93443559 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAGCAGTTCTGTGACCAT Chr1:93440757..93440776 60.12 55 GCAGCACCAGACAGACTTCTC Chr1:93443537..93443557 60.2 57.14

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000659845 Chr1:93437121..93437441 GACAGCGTTGCTCTCTGACA Chr1:93437310..93437329 60.34 55
upstream ENSMUSE00000364883 Chr1:93437142..93437441 GACAGCGTTGCTCTCTGACA Chr1:93437310..93437329 60.34 55
upstream ENSMUSE00000659843 Chr1:93437657..93437752 TAACTGCCACCCTGTTAGCC Chr1:93437679..93437698 60.13 55
upstream ENSMUSE00000598290 Chr1:93440728..93440874 GGGAGCAGTTCTGTGACCAT Chr1:93440757..93440776 60.12 55
upstream ENSMUSE00000288340 Chr1:93440733..93440874 GGGAGCAGTTCTGTGACCAT Chr1:93440757..93440776 60.12 55

*** Putative Vector Insertion (Chr 1: 93440875 - 93443504) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000288375 Chr1:93443505..93443807 AAGTGCCCGTTCACTACAGC Chr1:93443687..93443706 60.32 55
downstream ENSMUSE00000693965 Chr1:93443505..93443559 GCAGCACCAGACAGACTTCTC Chr1:93443537..93443557 60.2 57.14
downstream ENSMUSE00000693962 Chr1:93443621..93443671 AGCCACATACAGGGCAGTCT Chr1:93443670..93443689 59.75 55
downstream ENSMUSE00000157854 Chr1:93448631..93449016 CCACTTCACCAGGTTCAGGT Chr1:93448943..93448962 60 55
downstream ENSMUSE00000481666 Chr1:93451328..93456167 AAGGAGAGCAACGAGGTGAA Chr1:93454889..93454908 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTACCGGAGGTGAGCATT Chr1:93440865..93440885 61.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTACCGGAGGTGAGCATT Chr1:93440865..93440885 61.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026311