Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34923
Trapped Gene
Ap1m2 (ENSMUSG00000003309)
Vector Insertion
Chr 9: 21103722 - 21106972
Public Clones IST14888D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217397 (Chr9:21106900..21106971 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAGTGGAGATCATGGTGAA Chr9:21106901..21106920 59.63 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217397 (Chr9:21106900..21106971 -)
Downstram Exon
ENSMUSE00000293368 (Chr9:21103723..21103881 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAGTGGAGATCATGGTGAA Chr9:21106901..21106920 59.63 50 ATCACTAGGAACGGGCACAG Chr9:21103791..21103810 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000293525 Chr9:21116651..21116755 CCTCCTAGCTTCACGGACTG Chr9:21116698..21116717 60.01 60
upstream ENSMUSE00000217393 Chr9:21114080..21114236 GTGATGTGCCCATGACAGAG Chr9:21114192..21114211 60.12 55
upstream ENSMUSE00000217396 Chr9:21113811..21113878 CACGCTGAAGAACGCTAATG Chr9:21113849..21113868 59.63 50
upstream ENSMUSE00000217394 Chr9:21109937..21110215 TACAGTCACCAATGCGGTGT Chr9:21110011..21110030 60.03 50
upstream ENSMUSE00000217392 Chr9:21109726..21109852 GGTGTTTCTGTCTGGGATGC Chr9:21109777..21109796 60.52 55
upstream ENSMUSE00000217395 Chr9:21107067..21107209 CTTTCACGCTTTGACAACGA Chr9:21107134..21107153 60.03 45
upstream ENSMUSE00000702878 Chr9:21107067..21107215 CTTTCACGCTTTGACAACGA Chr9:21107134..21107153 60.03 45
upstream ENSMUSE00000217397 Chr9:21106900..21106971 CGAGTGGAGATCATGGTGAA Chr9:21106901..21106920 59.63 50
upstream ENSMUSE00000293368 Chr9:21103723..21103881 CTGTGCCCGTTCCTAGTGAT Chr9:21103813..21103832 60.13 55

*** Putative Vector Insertion (Chr 9: 21103722 - 21106972) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000538579 Chr9:21102644..21102769 GGCACGCATCAAGTACTCCT Chr9:21102721..21102740 60.28 55
downstream ENSMUSE00000538577 Chr9:21100877..21100952 TGGTACCCACTTTTCTCGATG Chr9:21100893..21100913 59.98 47.62
downstream ENSMUSE00000584923 Chr9:21099905..21100298 AGATGGAAGCCCCACTTCTT Chr9:21100227..21100246 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:21106902..21106922 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTCTCGCACACGTGACTG Chr9:21103913..21103933 59.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003309