Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34924
Trapped Gene
Gripap1 (ENSMUSG00000031153)
Vector Insertion
Chr X: 7387848 - 7389407
Public Clones IST14888D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000241939 (ChrX:7387734..7387847 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCAGGCTCAGGTACACTCC ChrX:7387780..7387799 60.26 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000241939 (ChrX:7387734..7387847 +)
Downstram Exon
ENSMUSE00000241929 (ChrX:7389408..7389485 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCAGGCTCAGGTACACTCC ChrX:7387780..7387799 60.26 60 TGAGGGTTTCCTCTTGTTCC ChrX:7389453..7389472 59.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000428474 ChrX:7367119..7367194 AGGAGTTTCAACGGATGCAG ChrX:7367175..7367194 60.26 50
upstream ENSMUSE00000206904 ChrX:7369196..7369262 TGGAGCTCCGGACAAATAAC ChrX:7369206..7369225 60.07 50
upstream ENSMUSE00000206906 ChrX:7369402..7369463 AGAAGGTCGCCTACCTGGAT ChrX:7369420..7369439 60.1 55
upstream ENSMUSE00000703805 ChrX:7371386..7371412 No primer for this exon
upstream ENSMUSE00000242032 ChrX:7372118..7372225 AGGAGGAGGACTTCCGTTTG ChrX:7372173..7372192 60.62 55
upstream ENSMUSE00000242023 ChrX:7376416..7376554 GGAAAACCGACAACTCAAGG ChrX:7376445..7376464 59.57 50
upstream ENSMUSE00000242011 ChrX:7377283..7377467 CAGGAACGCTATGGGAAAGA ChrX:7377288..7377307 60.21 50
upstream ENSMUSE00000242003 ChrX:7377662..7377709 AAAGCAAGCTGAAACCTCCA ChrX:7377667..7377686 59.99 45
upstream ENSMUSE00000241995 ChrX:7378303..7378334 No primer for this exon
upstream ENSMUSE00000241988 ChrX:7378430..7378477 No primer for this exon
upstream ENSMUSE00000241982 ChrX:7378616..7378715 AAGAATTGCAACAGCGGAAG ChrX:7378627..7378646 60.39 45
upstream ENSMUSE00000241973 ChrX:7380449..7380526 No primer for this exon
upstream ENSMUSE00000703804 ChrX:7380720..7380812 TGAGGACTAGCTTGGCTGCT ChrX:7380784..7380803 60.3 55
upstream ENSMUSE00000241966 ChrX:7381486..7381620 ATGACCTCAACTCGCAGCTC ChrX:7381598..7381617 60.56 55
upstream ENSMUSE00000241957 ChrX:7387019..7387114 AGGAGCAGCTAACCCAGGAT ChrX:7387077..7387096 60.23 55
upstream ENSMUSE00000241948 ChrX:7387379..7387591 GGCAGATTCGTGAGGAGAAG ChrX:7387572..7387591 59.95 55
upstream ENSMUSE00000241939 ChrX:7387734..7387847 TCCAGGCTCAGGTACACTCC ChrX:7387780..7387799 60.26 60

*** Putative Vector Insertion (Chr X: 7387848 - 7389407) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000241929 ChrX:7389408..7389485 TGAGGGTTTCCTCTTGTTCC ChrX:7389453..7389472 59.11 50
downstream ENSMUSE00000710030 ChrX:7389591..7389686 CCCGAACATTCTGAAGCTCT ChrX:7389624..7389643 59.43 50
downstream ENSMUSE00000720821 ChrX:7389591..7389686 CCCGAACATTCTGAAGCTCT ChrX:7389624..7389643 59.43 50
downstream ENSMUSE00000241910 ChrX:7389808..7389864 CTGCCCGTCTACTGTGTCCT ChrX:7389837..7389856 60.32 60
downstream ENSMUSE00000703784 ChrX:7389808..7389864 CTGCCCGTCTACTGTGTCCT ChrX:7389837..7389856 60.32 60
downstream ENSMUSE00000241902 ChrX:7389958..7390057 CGGCTCTTGCTGTTGGTAAG ChrX:7390055..7390074 60.95 55
downstream ENSMUSE00000703783 ChrX:7389958..7390057 CGGCTCTTGCTGTTGGTAAG ChrX:7390055..7390074 60.95 55
downstream ENSMUSE00000241893 ChrX:7391694..7391824 CAAGATCTCCCGGTAGCTGA ChrX:7391794..7391813 60.35 55
downstream ENSMUSE00000703782 ChrX:7391694..7391824 CAAGATCTCCCGGTAGCTGA ChrX:7391794..7391813 60.35 55
downstream ENSMUSE00000241885 ChrX:7395153..7395275 GCCTGAGGACTGCTGGATAG ChrX:7395178..7395197 59.97 60
downstream ENSMUSE00000703781 ChrX:7395153..7395275 GCCTGAGGACTGCTGGATAG ChrX:7395178..7395197 59.97 60
downstream ENSMUSE00000241875 ChrX:7395422..7395515 GCAGAGATCTTCCGCCATAG ChrX:7395472..7395491 59.94 55
downstream ENSMUSE00000703780 ChrX:7395422..7395515 GCAGAGATCTTCCGCCATAG ChrX:7395472..7395491 59.94 55
downstream ENSMUSE00000241863 ChrX:7396293..7396447 TCCAACATGTTCTGCAGCTT ChrX:7396416..7396435 59.44 45
downstream ENSMUSE00000703779 ChrX:7396293..7396447 TCCAACATGTTCTGCAGCTT ChrX:7396416..7396435 59.44 45
downstream ENSMUSE00000516774 ChrX:7397128..7397687 ACACGTTGCTGGAACATTGA ChrX:7397623..7397642 60.16 45
downstream ENSMUSE00000703778 ChrX:7397128..7397687 ACACGTTGCTGGAACATTGA ChrX:7397623..7397642 60.16 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTGAAGGAAGCTGAGGTG ChrX:7387832..7387852 60.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTGAAGGAAGCTGAGGTG ChrX:7387832..7387852 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031153