Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34925
Trapped Gene
Rhox13 (ENSMUSG00000050197)
Vector Insertion
Chr X: 35476297 - 35482918
Public Clones IST13286F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000408029 (ChrX:35476251..35476296 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCTGAGGTCAAAGTGAAG ChrX:35476277..35476296 59.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000408029 (ChrX:35476251..35476296 +)
Downstram Exon
ENSMUSE00000335968 (ChrX:35482919..35483143 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCTGAGGTCAAAGTGAAG ChrX:35476277..35476296 59.01 50 TCGCTCTCCGATTGGTAAAC ChrX:35482946..35482965 60.21 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000369915 ChrX:35474876..35474999 CCAGTACCCGGATTTGCTTA ChrX:35474976..35474995 59.95 50
upstream ENSMUSE00000408029 ChrX:35476251..35476296 TGCCTGAGGTCAAAGTGAAG ChrX:35476277..35476296 59.01 50

*** Putative Vector Insertion (Chr X: 35476297 - 35482918) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000335968 ChrX:35482919..35483143 TCGCTCTCCGATTGGTAAAC ChrX:35482946..35482965 60.21 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGAATGTGCCTGAGGTCAA ChrX:35479271..35479291 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAGCCTCGTGACTGGGAAA ChrX:35476341..35476361 59.69 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050197