Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34926
Trapped Gene
4930486L24Rik (ENSMUSG00000050345)
Vector Insertion
Chr 13: 60946440 - 60954686
Public Clones IST11906B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000333132 (Chr13:60954461..60954685 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGCTTTTAGTGCAACTGGA Chr13:60954647..60954666 60.25 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000333132 (Chr13:60954461..60954685 -)
Downstram Exon
ENSMUSE00000117831 (Chr13:60946441..60946603 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGCTTTTAGTGCAACTGGA Chr13:60954647..60954666 60.25 50 GCCTTCATAAGGGCTTCCTC Chr13:60946490..60946509 60.17 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000570717 Chr13:60965683..60965778 GGAAATCGTCTGAGGAGCAG Chr13:60965694..60965713 59.95 55
upstream ENSMUSE00000570716 Chr13:60956174..60956310 TCCTCTGCTTGGAAATCGAC Chr13:60956255..60956274 60.34 50
upstream ENSMUSE00000413713 Chr13:60955117..60955239 GGGAAGCATGACTTCACCAT Chr13:60955142..60955161 59.93 50
upstream ENSMUSE00000367715 Chr13:60954877..60955023 GGCTTTCGAAGGCAGAAGAT Chr13:60954974..60954993 60.85 50
upstream ENSMUSE00000333132 Chr13:60954461..60954685 GGGCTTTTAGTGCAACTGGA Chr13:60954647..60954666 60.25 50
upstream ENSMUSE00000117831 Chr13:60946441..60946603 GAAGGCAGTGGCTAAAGTGG Chr13:60946498..60946517 59.88 55

*** Putative Vector Insertion (Chr 13: 60946440 - 60954686) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000570715 Chr13:60945670..60945787 TTAGGTGGACCCTTTTGCAC Chr13:60945727..60945746 59.97 50
downstream ENSMUSE00000520730 Chr13:60943982..60944337 GCTCAGACGATGGGGTATGT Chr13:60944214..60944233 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGGCTTTTAGTGCAACTG Chr13:60948647..60948667 58.96 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGATCCCTAGAAGCGTGAC Chr13:60948629..60948649 60.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050345