Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34930
Trapped Gene
Itga11 (ENSMUSG00000032243)
Vector Insertion
Chr 9: 62544803 - 62575412
Public Clones IST14339G2 (tigm) IST11184C5 (tigm) IST13755G11 (tigm) IST13066B12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000329689 (Chr9:62544691..62544802 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGCCTTCTTTGGCTACAC Chr9:62544750..62544769 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000329689 (Chr9:62544691..62544802 +)
Downstram Exon
ENSMUSE00000422388 (Chr9:62575413..62575513 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGCCTTCTTTGGCTACAC Chr9:62544750..62544769 60.02 55 AGGTTGAGCTTGGTGCAGTT Chr9:62575514..62575533 59.91 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636261 Chr9:62525668..62525803 No primer for this exon
upstream ENSMUSE00000329689 Chr9:62544691..62544802 GCTGCCTTCTTTGGCTACAC Chr9:62544750..62544769 60.02 55

*** Putative Vector Insertion (Chr 9: 62544803 - 62575412) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000422388 Chr9:62575413..62575513 AGGTTGAGCTTGGTGCAGTT Chr9:62575514..62575533 59.91 50
downstream ENSMUSE00000218076 Chr9:62578518..62578609 CGCATGTTGTCCTTCCTCTC Chr9:62578566..62578585 60.8 55
downstream ENSMUSE00000218082 Chr9:62579889..62580003 AGTTGGAGTTGACCCGTGAG Chr9:62579970..62579989 60.15 55
downstream ENSMUSE00000218080 Chr9:62583076..62583203 AGGGGTAGATGCTGTTGGAG Chr9:62583138..62583157 59.16 55
downstream ENSMUSE00000329584 Chr9:62585176..62585324 GAACTCATGGACGGCATCTT Chr9:62585220..62585239 60.08 50
downstream ENSMUSE00000218064 Chr9:62591733..62591877 ATCACTTTCTTGGCCCCTTT Chr9:62591783..62591802 59.94 45
downstream ENSMUSE00000515525 Chr9:62592289..62592454 GCGGTTGTAGTAGCCCAAAA Chr9:62592312..62592331 60.13 50
downstream ENSMUSE00000514636 Chr9:62593713..62593783 AAAGCCAGTCTGCGACATCT Chr9:62593768..62593787 60.02 50
downstream ENSMUSE00000218084 Chr9:62599312..62599456 GGACTCTCGGTGAGGAATCA Chr9:62599410..62599429 60.2 55
downstream ENSMUSE00000218068 Chr9:62600051..62600199 TGACCTTGCCAGTATGGTTG Chr9:62600140..62600159 59.57 50
downstream ENSMUSE00000218072 Chr9:62602979..62603119 CATACACCTTGCCTCGCTCT Chr9:62603105..62603124 60.42 55
downstream ENSMUSE00000218061 Chr9:62603377..62603580 GCATGGGCTTCTTCAGGATA Chr9:62603581..62603600 60.18 50
downstream ENSMUSE00000329452 Chr9:62605412..62605542 CAGCTCCGAGGCTGTTATTC Chr9:62605435..62605454 59.98 55
downstream ENSMUSE00000329438 Chr9:62608095..62608261 GACGGTTGCTGTTTGGAAGT Chr9:62608263..62608282 60.16 50
downstream ENSMUSE00000329424 Chr9:62609338..62609480 TCTCATCCATGGTTGCATTG Chr9:62609370..62609389 60.48 45
downstream ENSMUSE00000329406 Chr9:62610614..62610724 GCCACTGGCTTCACGTAGTC Chr9:62610645..62610664 60.87 60
downstream ENSMUSE00000218079 Chr9:62613567..62613652 CCGAGCATCCAGTACAAGGT Chr9:62613635..62613654 60.13 55
downstream ENSMUSE00000218073 Chr9:62615403..62615610 CGCGTGCTCTCTATGATGAA Chr9:62615501..62615520 60.12 50
downstream ENSMUSE00000329268 Chr9:62616334..62616432 TCTCCTCGTTCACACACTCG Chr9:62616376..62616395 60.02 55
downstream ENSMUSE00000329248 Chr9:62617054..62617130 CTCGAAATCCAGACGGAAAG Chr9:62617080..62617099 59.81 50
downstream ENSMUSE00000218071 Chr9:62619152..62619241 GTGCTGTCTTGCTCGTGACT Chr9:62619178..62619197 59.21 55
downstream ENSMUSE00000218062 Chr9:62620767..62620857 GAGGTCCGATGCCATCATAG Chr9:62620840..62620859 60.45 55
downstream ENSMUSE00000218077 Chr9:62621884..62621997 GATGGGCACAGTGATCTTCA Chr9:62621946..62621965 59.64 50
downstream ENSMUSE00000218060 Chr9:62622105..62622191 TTCCCCCAGATGTTACAGGA Chr9:62622136..62622155 60.31 50
downstream ENSMUSE00000329157 Chr9:62624420..62624530 CTCAGGTTGCAGATGATGGA Chr9:62624466..62624485 59.79 50
downstream ENSMUSE00000329125 Chr9:62624661..62624756 TTCCTCTCGGAAGATGAAGG Chr9:62624744..62624763 59.36 50
downstream ENSMUSE00000218081 Chr9:62629743..62629856 GCCAGTCTTCTTGCTTGGAG Chr9:62629779..62629798 60.13 55
downstream ENSMUSE00000413826 Chr9:62630435..62631755 GTACCGCATAGGGGAACAGA Chr9:62631709..62631728 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGGGAGGTCCTGACATTT Chr9:62574797..62574817 59.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATCAACATGGCTGTCGTGA Chr9:62574839..62574859 60.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032243