Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34932
Trapped Gene
Rab13 (ENSMUSG00000027935)
Vector Insertion
Chr 3: 90017745 - 90024738
Public Clones (sanger) IST14912H6 (tigm) IST15076G3 (tigm) IST10982E10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672921 (Chr3:90017617..90017744 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGTCCGTAAAGGCTCCTC Chr3:90017703..90017722 59.71 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672921 (Chr3:90017617..90017744 +)
Downstram Exon
ENSMUSE00000566764 (Chr3:90024739..90024944 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGTCCGTAAAGGCTCCTC Chr3:90017703..90017722 59.71 55 GCAAAGCGAATGATCAGACA Chr3:90024909..90024928 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672921 Chr3:90017617..90017744 AAGGTCCGTAAAGGCTCCTC Chr3:90017703..90017722 59.71 55

*** Putative Vector Insertion (Chr 3: 90017745 - 90024738) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000566764 Chr3:90024739..90024944 GCAAAGCGAATGATCAGACA Chr3:90024909..90024928 59.96 45
downstream ENSMUSE00000305414 Chr3:90026159..90026219 CACGGTTCGGATCTTGAAAT Chr3:90026187..90026206 59.93 45
downstream ENSMUSE00000672920 Chr3:90026159..90026219 CACGGTTCGGATCTTGAAAT Chr3:90026187..90026206 59.93 45
downstream ENSMUSE00000174453 Chr3:90027449..90027509 CTCCACGGTAATAGGCGGTA Chr3:90027507..90027526 59.97 55
downstream ENSMUSE00000672919 Chr3:90027449..90027509 CTCCACGGTAATAGGCGGTA Chr3:90027507..90027526 59.97 55
downstream ENSMUSE00000174454 Chr3:90027712..90027789 No primer for this exon
downstream ENSMUSE00000174448 Chr3:90028416..90028505 GTCACACTTGTTTCCCAGCA Chr3:90028466..90028485 59.73 50
downstream ENSMUSE00000174450 Chr3:90028624..90028689 ACTGGATTTGGCACTCGTCT Chr3:90028677..90028696 59.73 50
downstream ENSMUSE00000174451 Chr3:90028770..90028823 No primer for this exon
downstream ENSMUSE00000456693 Chr3:90029431..90029885 GCTTGAGGGCTTACTGTTGG Chr3:90029457..90029476 59.88 55
downstream ENSMUSE00000672918 Chr3:90029431..90030307 ACAGGATGTCCGTCCTTCAG Chr3:90030068..90030087 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCGGAATGTATGTTGAGG Chr3:90020739..90020759 59.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCGGAATGTATGTTGAGG Chr3:90020739..90020759 59.67 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027935