Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34938
Trapped Gene
Gm347 (ENSMUSG00000035829)
Vector Insertion
Chr 2: 28304429 - 28305821
Public Clones IST14342E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000518084 (Chr2:28304212..28304428 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCAGAGCATCAGCCTACAC Chr2:28304396..28304415 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000518084 (Chr2:28304212..28304428 +)
Downstram Exon
ENSMUSE00000226962 (Chr2:28305822..28311025 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCAGAGCATCAGCCTACAC Chr2:28304396..28304415 60.17 55 CAGGGGCTAAAAGCACTCAG Chr2:28310945..28310964 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000519064 Chr2:28303461..28303502 CTCAGTTCTGGGTCCATCGT Chr2:28303467..28303486 60.11 55
upstream ENSMUSE00000518084 Chr2:28304212..28304428 TGCAGAGCATCAGCCTACAC Chr2:28304396..28304415 60.17 55

*** Putative Vector Insertion (Chr 2: 28304429 - 28305821) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000226962 Chr2:28305822..28311025 CAGGGGCTAAAAGCACTCAG Chr2:28310945..28310964 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCAGAGCATCAGCCTACA Chr2:28304396..28304416 60.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCAGAGCATCAGCCTACA Chr2:28304396..28304416 60.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035829