Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34940
Trapped Gene
C5ar1 (ENSMUSG00000049130)
Vector Insertion
Chr 7: 16832091 - 16844601
Public Clones IST14432G12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000599829 (Chr7:16844494..16844600 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTTACCACAGAACCCAGGA Chr7:16844508..16844527 59.82 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000599829 (Chr7:16844494..16844600 -)
Downstram Exon
ENSMUSE00000365309 (Chr7:16832092..16834439 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTTACCACAGAACCCAGGA Chr7:16844508..16844527 59.82 55 ACGGTCGGCACTAATGGTAG Chr7:16834019..16834038 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000599829 Chr7:16844494..16844600 GGTTACCACAGAACCCAGGA Chr7:16844508..16844527 59.82 55
upstream ENSMUSE00000365309 Chr7:16832092..16834439 GTCCTGTTCACGACCGTTTT Chr7:16834153..16834172 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr7:16832530..16832550 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTGCGTGACTGGGAAAAC Chr7:16832535..16832555 62.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049130