Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34944
Trapped Gene
Reln (ENSMUSG00000042453)
Vector Insertion
Chr 5: 21660762 - 21677099
Public Clones IST13985H9 (tigm) IST10655D1 (tigm) IST13358A5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000266576 (Chr5:21677028..21677098 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATAGGGGCCAGGTGATTTTC Chr5:21677065..21677084 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000266576 (Chr5:21677028..21677098 -)
Downstram Exon
ENSMUSE00000266571 (Chr5:21660763..21660795 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATAGGGGCCAGGTGATTTTC Chr5:21677065..21677084 60.15 50 CAAGGTGCGAGTAAGCAGTG Chr5:21660741..21660760 59.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000602843 Chr5:21850238..21850270 No primer for this exon
upstream ENSMUSE00000266593 Chr5:21849998..21850235 GTACCGGGACAGGAATACCA Chr5:21850000..21850019 59.67 55
upstream ENSMUSE00000552030 Chr5:21849998..21850523 CCTCCGAAAGTGGATGAGAG Chr5:21850264..21850283 59.8 55
upstream ENSMUSE00000552020 Chr5:21847887..21849920 GCCCCTTAGCAGACGTGTAG Chr5:21848517..21848536 59.9 60
upstream ENSMUSE00000266584 Chr5:21792711..21792821 ACCTCGACAAGCATCCAGTC Chr5:21792749..21792768 60.27 55
upstream ENSMUSE00000266580 Chr5:21733343..21733478 ATCATGTCCGACCACCAGTT Chr5:21733457..21733476 60.25 50
upstream ENSMUSE00000266576 Chr5:21677028..21677098 ATAGGGGCCAGGTGATTTTC Chr5:21677065..21677084 60.15 50
upstream ENSMUSE00000266571 Chr5:21660763..21660795 CACTGCTTACTCGCACCTTG Chr5:21660763..21660782 59.66 55

*** Putative Vector Insertion (Chr 5: 21660762 - 21677099) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000266567 Chr5:21658226..21658304 GGGTTCAATTCCAGTTGCTG Chr5:21658213..21658232 60.49 50
downstream ENSMUSE00000266563 Chr5:21640415..21640511 CCATCTCACAGTTGCTGCAT Chr5:21640464..21640483 59.86 50
downstream ENSMUSE00000266559 Chr5:21634433..21634484 GTTGTGTTCAGGCATGTGGT Chr5:21634440..21634459 59.45 50
downstream ENSMUSE00000266554 Chr5:21611827..21611923 GGCGTATGACACAGTGATGC Chr5:21611846..21611865 60.15 55
downstream ENSMUSE00000266548 Chr5:21609042..21609282 TCTGTGGGCTGAATTGATGA Chr5:21609095..21609114 60.2 45
downstream ENSMUSE00000266540 Chr5:21586496..21586641 ATTGAACTCGCTGCCTTCAT Chr5:21586557..21586576 59.84 45
downstream ENSMUSE00000381737 Chr5:21566067..21566218 TACGGTTCCACAGTCTGCAC Chr5:21566151..21566170 59.75 55
downstream ENSMUSE00000266526 Chr5:21557106..21557218 TCCAGGGTCACAGATTCCTC Chr5:21557177..21557196 60.05 55
downstream ENSMUSE00000266520 Chr5:21555422..21555630 TACCCTTGGTGGCTCTTTTG Chr5:21555520..21555539 60.1 50
downstream ENSMUSE00000266516 Chr5:21554536..21554664 TGTGGAGTAGGGACCAGGAC Chr5:21554590..21554609 59.96 60
downstream ENSMUSE00000266507 Chr5:21553761..21553870 GAATCGTGATTCGGTTCCAC Chr5:21553829..21553848 60.33 50
downstream ENSMUSE00000266500 Chr5:21550782..21550848 GCATTGTCCTCTGCCAGAAC Chr5:21550777..21550796 60.81 55
downstream ENSMUSE00000266494 Chr5:21546121..21546354 GCCTCCCATCTTTGTTGAAA Chr5:21546139..21546158 60.05 45
downstream ENSMUSE00000266486 Chr5:21545329..21545490 CTGGGCTCGTGGTAGTTGAC Chr5:21545307..21545326 60.71 60
downstream ENSMUSE00000266479 Chr5:21540381..21540617 CTGTCTTGCATCATCCGGTA Chr5:21540559..21540578 59.67 50
downstream ENSMUSE00000266473 Chr5:21524670..21524862 CACCTGGTTGTCCATGTGAG Chr5:21524699..21524718 60 55
downstream ENSMUSE00000266468 Chr5:21523841..21523953 AACTCGCTGGCATGGTAAAT Chr5:21523864..21523883 59.6 45
downstream ENSMUSE00000266460 Chr5:21516855..21516992 AGCTCTGACTCCAACGGAAG Chr5:21516936..21516955 59.6 55
downstream ENSMUSE00000444676 Chr5:21515934..21516120 CCAGAAGACACGACTCCACA Chr5:21515934..21515953 59.86 55
downstream ENSMUSE00000266446 Chr5:21509855..21510060 CCCCCGTTGTTGCTATACTG Chr5:21509887..21509906 60.38 55
downstream ENSMUSE00000266440 Chr5:21504359..21504530 GATATCATCAACGGCCCACT Chr5:21504397..21504416 59.78 50
downstream ENSMUSE00000266430 Chr5:21503704..21503904 TCGTTTTTAGCCATGCCTTC Chr5:21503794..21503813 60.21 45
downstream ENSMUSE00000266423 Chr5:21501171..21501403 CCTTCCTTCACCAGAAACCA Chr5:21501284..21501303 60.08 50
downstream ENSMUSE00000266414 Chr5:21494471..21494628 CCACTGCAGTAACTGGGACA Chr5:21494499..21494518 59.74 55
downstream ENSMUSE00000266405 Chr5:21492745..21492952 CCCTCAAACCTGTCGAACAT Chr5:21492867..21492886 59.97 50
downstream ENSMUSE00000266397 Chr5:21491615..21491691 TTGATGCACGTAATCCCTGA Chr5:21491613..21491632 60.07 45
downstream ENSMUSE00000266390 Chr5:21485786..21485944 AAAGCTGTGGCAGGTGTCTT Chr5:21485787..21485806 59.91 50
downstream ENSMUSE00000266382 Chr5:21485395..21485583 GACATCATCCAAAGCCCACT Chr5:21485527..21485546 59.93 50
downstream ENSMUSE00000266373 Chr5:21484605..21484878 AGAAGCTTGACGCTGACACA Chr5:21484803..21484822 59.78 50
downstream ENSMUSE00000266366 Chr5:21482348..21482488 ATCACAGATCCCTCGTCCTG Chr5:21482340..21482359 60.07 55
downstream ENSMUSE00000266360 Chr5:21482067..21482244 CTCTCTGCCCCGTACACTTC Chr5:21482100..21482119 59.87 60
downstream ENSMUSE00000266352 Chr5:21478673..21478757 No primer for this exon
downstream ENSMUSE00000266342 Chr5:21477685..21477867 GTTTGGGCACCGTATGGTAA Chr5:21477704..21477723 60.62 50
downstream ENSMUSE00000266335 Chr5:21475050..21475221 ACGGGCAGTAAAGTCCGATA Chr5:21475047..21475066 59.59 50
downstream ENSMUSE00000266325 Chr5:21474847..21474949 TGGAGTGTTCTCCAACTTCG Chr5:21474875..21474894 58.85 50
downstream ENSMUSE00000358730 Chr5:21466072..21466301 GACCGGATCAGCAGAAGAAC Chr5:21466235..21466254 59.81 55
downstream ENSMUSE00000350883 Chr5:21460862..21461082 TTTTACAGGTTGGCCCAGAG Chr5:21460882..21460901 60.1 50
downstream ENSMUSE00000266303 Chr5:21456637..21456784 CCAGGTCCCGTGTTACTAGC Chr5:21456631..21456650 59.62 60
downstream ENSMUSE00000266296 Chr5:21454190..21454448 TGGGGTCTGGAACACCTTTA Chr5:21454374..21454393 60.35 50
downstream ENSMUSE00000266289 Chr5:21453102..21453351 TTCACAGCGATGTCTGTCGT Chr5:21453142..21453161 60.47 50
downstream ENSMUSE00000266280 Chr5:21448417..21448585 AGACCGAGATCCACCGAGTA Chr5:21448530..21448549 59.68 55
downstream ENSMUSE00000266274 Chr5:21438518..21438658 GGAAACGAGTGGCTTGAGAC Chr5:21438617..21438636 59.85 55
downstream ENSMUSE00000496361 Chr5:21437176..21437353 GGCTCGGTTGAAGTTGTCTT Chr5:21437247..21437266 59.33 50
downstream ENSMUSE00000501252 Chr5:21434882..21435075 TCAGCATTGGTGAGGTTCAG Chr5:21435004..21435023 59.83 50
downstream ENSMUSE00000266254 Chr5:21431008..21431264 ATTGTCAATGGCCCAGTCAT Chr5:21431134..21431153 60.2 45
downstream ENSMUSE00000266247 Chr5:21426225..21426379 CTGCATACACCTCTCGTCCA Chr5:21426250..21426269 59.85 55
downstream ENSMUSE00000266238 Chr5:21424833..21425047 AAGCGGGTAGGTGATCCTTT Chr5:21424831..21424850 59.96 50
downstream ENSMUSE00000444299 Chr5:21420801..21420978 CAGGGCCAAGGTAGAAATTG Chr5:21420883..21420902 59.56 50
downstream ENSMUSE00000266226 Chr5:21419017..21419192 GTACAAGTGCTTCCGCCTTC Chr5:21419091..21419110 59.88 55
downstream ENSMUSE00000507771 Chr5:21418794..21418900 TTGTTCTCACTGCCGATACG Chr5:21418840..21418859 59.86 50
downstream ENSMUSE00000509546 Chr5:21416631..21416873 CCAGTTGGCTTGGATTGATT Chr5:21416627..21416646 59.93 45
downstream ENSMUSE00000519648 Chr5:21415759..21415934 GCATTGTGGGTCTTGTCCTT Chr5:21415789..21415808 59.97 50
downstream ENSMUSE00000487865 Chr5:21410483..21410556 AGCATCACGGAATGAAGGTC Chr5:21410482..21410501 60.08 50
downstream ENSMUSE00000464567 Chr5:21408596..21408757 GGAAGGTAGGCACTGGGTCT Chr5:21408693..21408712 60.51 60
downstream ENSMUSE00000468582 Chr5:21407423..21407580 GATGTACACGTGGTCGATGG Chr5:21407483..21407502 59.84 55
downstream ENSMUSE00000470400 Chr5:21404804..21405023 ACAGCCACTTCCGATCACTC Chr5:21404880..21404899 60.27 55
downstream ENSMUSE00000469655 Chr5:21402565..21402762 GGTGATGCCATTGTTGACAC Chr5:21402614..21402633 59.82 50
downstream ENSMUSE00000478610 Chr5:21401807..21401905 CCAGCGCAGTAGAACTCCTT Chr5:21401850..21401869 59.64 55
downstream ENSMUSE00000701833 Chr5:21401803..21401905 CCAGCGCAGTAGAACTCCTT Chr5:21401850..21401869 59.64 55
downstream ENSMUSE00000701837 Chr5:21397380..21397385 No primer for this exon
downstream ENSMUSE00000503469 Chr5:21391291..21391387 AAGCGACCTTCGTCTTCTGT Chr5:21391284..21391303 59.09 50
downstream ENSMUSE00000701832 Chr5:21390272..21391389 GGAAACAACCCACGAAGAGA Chr5:21390407..21390426 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCAGGTGATTTTCAAAGA Chr5:21665058..21665078 60.05 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTACACGTGACTGGGAAAACC Chr5:21665032..21665053 59.88 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042453