Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34946
Trapped Gene
Dvl3 (ENSMUSG00000003233)
Vector Insertion
Chr 16: 20525852 - 20525978
Public Clones IST13317F1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000561557 (Chr16:20525712..20525851 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGCAATGAGCGAGGTGAT Chr16:20525748..20525767 59.84 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000561557 (Chr16:20525712..20525851 +)
Downstram Exon
ENSMUSE00000561555 (Chr16:20525979..20526055 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGCAATGAGCGAGGTGAT Chr16:20525748..20525767 59.84 45 CACAATCTCCCGAAGGACTC Chr16:20526047..20526066 59.65 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414406 Chr16:20517137..20517428 GCGGCCCAGCTATAAGTTCT Chr16:20517381..20517400 60.73 55
upstream ENSMUSE00000561563 Chr16:20522329..20522398 GGACGACAATGCCAAGCTAC Chr16:20522350..20522369 60.67 55
upstream ENSMUSE00000130957 Chr16:20523483..20523604 CCCTTTCTGTGCTGACAACC Chr16:20523518..20523537 60.69 55
upstream ENSMUSE00000130953 Chr16:20523725..20523834 TCTGGACAATGACACGGAGA Chr16:20523755..20523774 60.25 50
upstream ENSMUSE00000130947 Chr16:20524013..20524148 CGACTCAATGGAACCACAAA Chr16:20524018..20524037 59.54 45
upstream ENSMUSE00000130945 Chr16:20524325..20524418 CGCCTCATGAGAAGACACAA Chr16:20524359..20524378 59.98 50
upstream ENSMUSE00000130938 Chr16:20524592..20524661 CACCGTCACTCTCAACATGG Chr16:20524642..20524661 60.15 55
upstream ENSMUSE00000561557 Chr16:20525712..20525851 AAAGCAATGAGCGAGGTGAT Chr16:20525748..20525767 59.84 45

*** Putative Vector Insertion (Chr 16: 20525852 - 20525978) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000561555 Chr16:20525979..20526055 CACAATCTCCCGAAGGACTC Chr16:20526047..20526066 59.65 55
downstream ENSMUSE00000130939 Chr16:20526162..20526229 GTCCCAGCACTTGGCTACAG Chr16:20526198..20526217 60.85 60
downstream ENSMUSE00000130936 Chr16:20526340..20526489 GTGCTTAAGGAGGGGCTCAT Chr16:20526442..20526461 60.6 55
downstream ENSMUSE00000130962 Chr16:20527022..20527153 GATGAAAGCATTGGGAATGG Chr16:20527155..20527174 60.27 45
downstream ENSMUSE00000130933 Chr16:20527325..20527492 ACAGAGGTCGCCAAAGATGT Chr16:20527491..20527510 59.73 50
downstream ENSMUSE00000130960 Chr16:20530850..20531065 TCATGGTCGTGAAGCGATAG Chr16:20530883..20530902 59.82 50
downstream ENSMUSE00000315994 Chr16:20531153..20531589 ACTTGGAGTCCCCAGCTTTT Chr16:20531233..20531252 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTCGTGACTGGGAAAACC Chr16:20525899..20525919 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003233