Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34953
Trapped Gene
Kcnh2 (ENSMUSG00000038319)
Vector Insertion
Chr 5: 23854128 - 23857423
Public Clones IST12862D10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000263646 (Chr5:23857026..23857422 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACTAAGCAGAGCGGGAATC Chr5:23857253..23857272 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000263646 (Chr5:23857026..23857422 -)
Downstram Exon
ENSMUSE00000263641 (Chr5:23854129..23854359 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACTAAGCAGAGCGGGAATC Chr5:23857253..23857272 59.98 55 GTAGCCACACAGTTCGCAGA Chr5:23854252..23854271 60.06 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000263646 Chr5:23857026..23857422 CACTAAGCAGAGCGGGAATC Chr5:23857253..23857272 59.98 55
upstream ENSMUSE00000263641 Chr5:23854129..23854359 CGCAAGTTCATCATCGCTAA Chr5:23854338..23854357 59.98 45

*** Putative Vector Insertion (Chr 5: 23854128 - 23857423) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000263638 Chr5:23838710..23838874 GGGTACCACATCCACCAGAC Chr5:23838818..23838837 60.1 60
downstream ENSMUSE00000263630 Chr5:23837481..23837930 CTGAGGCATCAGGGTTAAGG Chr5:23837591..23837610 59.69 55
downstream ENSMUSE00000263621 Chr5:23836729..23836940 GGTGACCTTCTCGGTGACAT Chr5:23836710..23836729 59.97 55
downstream ENSMUSE00000701676 Chr5:23834983..23835090 No primer for this exon
downstream ENSMUSE00000263617 Chr5:23832167..23832595 GAGCCAAAGATGAGCAGGTC Chr5:23832158..23832177 59.96 55
downstream ENSMUSE00000263613 Chr5:23831312..23831699 AGTCCATGTGAGGCTGTTCC Chr5:23831494..23831513 60.12 55
downstream ENSMUSE00000602600 Chr5:23830774..23830973 GAGTACAGCCGCTGGATGAT Chr5:23830894..23830913 60.25 55
downstream ENSMUSE00000263602 Chr5:23830151..23830403 GCACTAGTGTGTCCCCTGGT Chr5:23830216..23830235 60.03 60
downstream ENSMUSE00000263596 Chr5:23828889..23829082 CATCACGATGGATCTTGTGC Chr5:23828950..23828969 60.08 50
downstream ENSMUSE00000263589 Chr5:23828473..23828572 GAGCCAGGAATCATGTTGGT Chr5:23828531..23828550 59.93 50
downstream ENSMUSE00000263584 Chr5:23827764..23828039 GCCCTCATCTTCACTGCTCT Chr5:23827869..23827888 59.56 55
downstream ENSMUSE00000263581 Chr5:23827454..23827640 TCGAGGCAACTCCTGGTACT Chr5:23827542..23827561 59.87 55
downstream ENSMUSE00000263576 Chr5:23827063..23827240 TCACAGCACTGTAGGCAGGA Chr5:23827127..23827146 60.62 55
downstream ENSMUSE00000411292 Chr5:23825408..23825967 AGGTGCTTCTGCACAGGTCT Chr5:23825690..23825709 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACTGTGTGACGAGCGAAT Chr5:23854433..23854453 62.47 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACTGTGTGACGAGCGAAT Chr5:23854433..23854453 62.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038319