Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34956
Trapped Gene
Col14a1 (ENSMUSG00000022371)
Vector Insertion
Chr 15: 55220245 - 55238189
Public Clones (sanger) (sanger) (sanger) IST14293D2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000126353 (Chr15:55220105..55220244 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAATTTGCGGATCTCCAATG Chr15:55220124..55220143 59.9 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000126353 (Chr15:55220105..55220244 +)
Downstram Exon
ENSMUSE00000126355 (Chr15:55238190..55238316 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAATTTGCGGATCTCCAATG Chr15:55220124..55220143 59.9 40 GACTGCCCCTCCTCGTAGAT Chr15:55238290..55238309 60.62 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683127 Chr15:55139305..55139539 GGTTCGCTAAGAACCAGTCG Chr15:55139457..55139476 59.88 55
upstream ENSMUSE00000477791 Chr15:55139306..55139539 GGTTCGCTAAGAACCAGTCG Chr15:55139457..55139476 59.88 55
upstream ENSMUSE00000227445 Chr15:55160711..55160835 No primer for this exon
upstream ENSMUSE00000719290 Chr15:55160711..55160835 No primer for this exon
upstream ENSMUSE00000227438 Chr15:55169961..55170077 GGTGGCTACAAACTGCTCGT Chr15:55170044..55170063 60.32 55
upstream ENSMUSE00000227430 Chr15:55173236..55173379 GACCAACCAGATGAATCTCCA Chr15:55173243..55173263 59.92 47.62
upstream ENSMUSE00000227420 Chr15:55176425..55176514 TCAAGGTTGTGGACAAAGGA Chr15:55176467..55176486 59.11 45
upstream ENSMUSE00000505386 Chr15:55193937..55194092 GATGGGTCGTGGAGTATTGG Chr15:55193990..55194009 60.19 55
upstream ENSMUSE00000475825 Chr15:55195006..55195125 CGAAGCCTTCCATACAAAGG Chr15:55195089..55195108 59.7 50
upstream ENSMUSE00000485717 Chr15:55197604..55197768 AACCTCCGTGAGTCTGGTGT Chr15:55197732..55197751 59.6 55
upstream ENSMUSE00000486729 Chr15:55204127..55204288 GGTTAAAAATGCCGACCTGA Chr15:55204128..55204147 59.94 45
upstream ENSMUSE00000227338 Chr15:55211055..55211206 CACTGCCAGGAGCTTTATGG Chr15:55211107..55211126 60.79 55
upstream ENSMUSE00000126365 Chr15:55212282..55212411 TTTGCAGTATCTGCCCACAC Chr15:55212357..55212376 59.72 50
upstream ENSMUSE00000227322 Chr15:55213981..55214126 GAAGGTCTGGCTGGAGATGA Chr15:55214100..55214119 60.35 55
upstream ENSMUSE00000227315 Chr15:55217768..55217897 GTGGGCTATTCCCCAATACA Chr15:55217805..55217824 59.65 50
upstream ENSMUSE00000126353 Chr15:55220105..55220244 AAATTTGCGGATCTCCAATG Chr15:55220124..55220143 59.9 40

*** Putative Vector Insertion (Chr 15: 55220245 - 55238189) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000126355 Chr15:55238190..55238316 GACTGCCCCTCCTCGTAGAT Chr15:55238290..55238309 60.62 60
downstream ENSMUSE00000126358 Chr15:55239275..55239414 CCATAGACCGGAATCCACAT Chr15:55239401..55239420 59.63 50
downstream ENSMUSE00000126366 Chr15:55240371..55240503 TTCGTACTCGGTTCCAGGAT Chr15:55240439..55240458 59.55 50
downstream ENSMUSE00000227238 Chr15:55241732..55241791 GTTCTATGGCTGTGGGTGCT Chr15:55241773..55241792 60.14 55
downstream ENSMUSE00000227232 Chr15:55243125..55243276 CCGCAGGCTAGTAGCAGTTT Chr15:55243186..55243205 59.68 55
downstream ENSMUSE00000683144 Chr15:55243125..55243267 CCGCAGGCTAGTAGCAGTTT Chr15:55243186..55243205 59.68 55
downstream ENSMUSE00000683143 Chr15:55247050..55247054 No primer for this exon
downstream ENSMUSE00000683142 Chr15:55250239..55250372 ACTCCAGGCACCATAACCTG Chr15:55250262..55250281 59.99 55
downstream ENSMUSE00000227226 Chr15:55250243..55250372 CTGACGCCTTCTCCAACAGT Chr15:55250352..55250371 60.44 55
downstream ENSMUSE00000227218 Chr15:55252373..55252495 CACCCGGTTGTACCATTCTT Chr15:55252431..55252450 59.71 50
downstream ENSMUSE00000227214 Chr15:55254936..55255085 CCACGAAGGTCTCCAGAGTT Chr15:55254968..55254987 59.3 55
downstream ENSMUSE00000227208 Chr15:55259439..55259555 ATGTATTTGCCACCGAGCAC Chr15:55259515..55259534 60.92 50
downstream ENSMUSE00000227200 Chr15:55268496..55268642 TCACACTGGGTCCCTCTAGC Chr15:55268627..55268646 60.26 60
downstream ENSMUSE00000227027 Chr15:55272855..55272911 GGAGGAAAAGTCGGTGGTTC Chr15:55272891..55272910 60.86 55
downstream ENSMUSE00000227168 Chr15:55276108..55276247 CTCCAAGATCCATCCACCAT Chr15:55276162..55276181 59.74 50
downstream ENSMUSE00000227161 Chr15:55277292..55277415 No primer for this exon
downstream ENSMUSE00000227019 Chr15:55277709..55277852 CCGTCCATCAGTTATCACCA Chr15:55277809..55277828 59.37 50
downstream ENSMUSE00000227013 Chr15:55278920..55279084 AGTAGTCAGCGTCAGCCACA Chr15:55278964..55278983 59.65 55
downstream ENSMUSE00000366935 Chr15:55279753..55279791 CTCCATCCTTGTGCACCATT Chr15:55279782..55279801 60.92 50
downstream ENSMUSE00000227128 Chr15:55280287..55280425 GCATGGGAACAAATTGAAGG Chr15:55280387..55280406 60.31 45
downstream ENSMUSE00000227122 Chr15:55281355..55281497 GTCAGGAAGAATCCGGAACA Chr15:55281424..55281443 60.05 50
downstream ENSMUSE00000227115 Chr15:55283827..55283936 GTCGGGTCCTTCAAAAGTGA Chr15:55283906..55283925 60.09 50
downstream ENSMUSE00000227110 Chr15:55286733..55286891 TCCGATGTGATATTCGCTGA Chr15:55286833..55286852 60.18 45
downstream ENSMUSE00000227105 Chr15:55295241..55295318 AGGAAGTTCGCAGCATCTGT Chr15:55295315..55295334 60.02 50
downstream ENSMUSE00000227094 Chr15:55298153..55298239 TCTGGGCAGGACTCTTCATC Chr15:55298178..55298197 60.35 55
downstream ENSMUSE00000227088 Chr15:55299515..55299568 CTTTTGGTCCTCGGAGTCCT Chr15:55299545..55299564 60.62 55
downstream ENSMUSE00000227007 Chr15:55303176..55303271 ATGCCTTGAATGGACAGACC Chr15:55303270..55303289 59.93 50
downstream ENSMUSE00000227081 Chr15:55304482..55304535 CTGTGGACCAGGAAGACCAG Chr15:55304538..55304557 60.7 60
downstream ENSMUSE00000561370 Chr15:55304835..55304888 No primer for this exon
downstream ENSMUSE00000226996 Chr15:55319487..55319540 No primer for this exon
downstream ENSMUSE00000446938 Chr15:55320021..55320092 No primer for this exon
downstream ENSMUSE00000412355 Chr15:55329033..55329068 GTTCACCTCGCTCTCCCTTC Chr15:55329069..55329088 61.31 60
downstream ENSMUSE00000446919 Chr15:55329971..55330037 TGAATGAGCTGCTCGCATAC Chr15:55330038..55330057 60.13 50
downstream ENSMUSE00000366743 Chr15:55332934..55333122 CTGGATGGTCCGGATAGATG Chr15:55333007..55333026 60.29 55
downstream ENSMUSE00000125912 Chr15:55347719..55347796 ACCTCTTGGGCCTTGAGTTC Chr15:55347783..55347802 60.63 55
downstream ENSMUSE00000125914 Chr15:55349737..55349892 AGGTCCAGGTACTCCCAGGT Chr15:55349831..55349850 59.85 60
downstream ENSMUSE00000683125 Chr15:55350692..55350723 No primer for this exon
downstream ENSMUSE00000125913 Chr15:55351488..55352356 GAACACCCGTGAAAACCAGT Chr15:55352087..55352106 59.87 50
downstream ENSMUSE00000683126 Chr15:55351488..55352358 GAACACCCGTGAAAACCAGT Chr15:55352087..55352106 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGTGATGAGGCAAGGATA Chr15:55220270..55220290 59.08 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGTGATGAGGCAAGGATA Chr15:55220270..55220290 59.08 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022371