Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34980
Trapped Gene
Lrrc50 (ENSMUSG00000031831)
Vector Insertion
Chr 8: 122106914 - 122112077
Public Clones PST24803-NR (escells) IST14977H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000213540 (Chr8:122106747..122106913 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGAACACACTGCAAATGG Chr8:122106760..122106779 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000213540 (Chr8:122106747..122106913 +)
Downstram Exon
ENSMUSE00000213538 (Chr8:122112078..122112199 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGAACACACTGCAAATGG Chr8:122106760..122106779 60.15 50 GTGCTTCAGACGGACAGTGA Chr8:122112161..122112180 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000579802 Chr8:122099135..122099367 GACGCGGACCGTAGAGTATT Chr8:122099213..122099232 59.22 55
upstream ENSMUSE00000318936 Chr8:122101231..122101366 CACCCACTCGAGAGATGACA Chr8:122101328..122101347 59.82 55
upstream ENSMUSE00000318922 Chr8:122103128..122103219 CCCTGAACGACACCCTGTAT Chr8:122103187..122103206 59.84 55
upstream ENSMUSE00000318907 Chr8:122106409..122106630 CCTGTTGCACAAGATCGAGA Chr8:122106539..122106558 59.98 50
upstream ENSMUSE00000213540 Chr8:122106747..122106913 CCTGAACACACTGCAAATGG Chr8:122106760..122106779 60.15 50

*** Putative Vector Insertion (Chr 8: 122106914 - 122112077) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213538 Chr8:122112078..122112199 GTGCTTCAGACGGACAGTGA Chr8:122112161..122112180 60.03 55
downstream ENSMUSE00000213544 Chr8:122114479..122114636 AAGGCTTCCAGGCTGTCTGT Chr8:122114589..122114608 61.36 55
downstream ENSMUSE00000579797 Chr8:122115601..122115858 ACCACATGCAGCTCCTTTTC Chr8:122115778..122115797 60.26 50
downstream ENSMUSE00000213549 Chr8:122118733..122118824 AGTTCTGGCCCCATCAGTAG Chr8:122118776..122118795 59.16 55
downstream ENSMUSE00000213534 Chr8:122119844..122119903 CCCTCAGCATCTTCCAAGTC Chr8:122119875..122119894 59.8 55
downstream ENSMUSE00000213547 Chr8:122120587..122120983 GGGTCACTGTCGTCACTCAA Chr8:122120645..122120664 59.71 55
downstream ENSMUSE00000481831 Chr8:122121471..122122354 AGCCTTAGCCTCCTGTCCTC Chr8:122122068..122122087 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCATGCCCTGTCTGGTAAG Chr8:122109900..122109920 60.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATGCCCTGTCTGGTAAGT Chr8:122106901..122106921 60.14 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031831