Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34981
Trapped Gene
OTTMUSG00000016574 (ENSMUSG00000078865)
Vector Insertion
Chr 2: 177359673 - 177362905
Public Clones PST17296-NL (escells) IST15016D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678582 (Chr2:177362835..177362904 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGTGTTTTGAGCGCCTCT Chr2:177362881..177362900 59.88 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678582 (Chr2:177362835..177362904 -)
Downstram Exon
ENSMUSE00000709929 (Chr2:177359674..177359728 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGTGTTTTGAGCGCCTCT Chr2:177362881..177362900 59.88 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678577 Chr2:177362835..177362915 AATGTGTTTTGAGCGCCTCT Chr2:177362881..177362900 59.88 45
upstream ENSMUSE00000678582 Chr2:177362835..177362904 AATGTGTTTTGAGCGCCTCT Chr2:177362881..177362900 59.88 45
upstream ENSMUSE00000709929 Chr2:177359674..177359728 No primer for this exon

*** Putative Vector Insertion (Chr 2: 177359673 - 177362905) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678581 Chr2:177356392..177356518 AGCCCACTCTTCCTGAGTGA Chr2:177356443..177356462 59.99 55
downstream ENSMUSE00000678580 Chr2:177356139..177356199 No primer for this exon
downstream ENSMUSE00000678575 Chr2:177355932..177356199 No primer for this exon
downstream ENSMUSE00000711203 Chr2:177353909..177354998 AAGGTCACTCCTTCCTGCAA Chr2:177353890..177353909 59.84 50
downstream ENSMUSE00000718806 Chr2:177353909..177354998 AAGGTCACTCCTTCCTGCAA Chr2:177353890..177353909 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGTCCCTTCAGCACACTC Chr2:177362889..177362909 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACTCCGTGACTGGGAAAA Chr2:177362840..177362860 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078865